Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig670  (registered. 2012)
Contig Information
Length 933 bp
Clones alternative view 51 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_h Spike at heading date 1
Wh_r Root 1
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 1
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 1
Wh_VHS Shoot with heat shock treatment 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 3
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XT Roots, 18 day old plants were grown hydroponically 3
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 11
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|193848510|gb|ACF22701.1|| ATP synthase [Brachypodium distachyon]
Score 323
Evalue 1.00E-86
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig670
TTTTTTTTTTGCAGCGAAATGTACTGTCATCATATTATTTCACAATTCATACTCACTGAATACGAGTAAAAGAGAGCACTTCAAACAAAAATTACAAACA
CTTGAATTAAAAACTTTCCATGACCTCTCTTCATGTTTTTATCCATGTTTTTGGTAGAAAGGAAATTAAAGATTGTTCAGCAGGCTTCTTCCTAACCCAC
AAGACAAAATAAAACAGAGTGATGTTCTCTTGTAAAGGAAAGCTTTTATTTCAAGACCACATCGAAGAAGCAGGCATGAGGGAACCTTCAGCGGCGCAAC
CACTGCACTCTGGTGTTGATTTGGATCCAAAAGGCAGTTAGATGTCAAAGGGTTGCCTCAAGAATGCCTCCATTTGCTTCGCCCTAGTCCTGATCGACAT
GTCAAACACCTTCTGCCCAAATTCAATCACCAGTCCTCCCATGATACCCTGGTCAATCTTTTGTTCAACCAAGATGGTTTTGTCTTTCCCAAGGATATCA
CGCAAGGTCTCCTTAAGTTCTTTCTCCTCCTTCTCAGGAAGTGGAACAACAGTCCTGACAACAACTTTCACCTCCCCCCTATGTGCCATGGTCAAATCAA
CAAATCTCTCAGCAATGCGTTCAACATATTTCAGTCTTCCATTGGATGCCAATGCAGACAAGAATTTCTTTGTGATGTCAGTAAACCCGGCTTCAGAGAA
TATTTCAGTTATAGCCTTCACCCTGGTTTCTTTAGGCACTGATGTGTCCTTCATGAATTGAGAAAACATAGGGCTCTTCTTGGATGCCCCTACAACATCG
AGAATCTCAGATTCAACTTTTTCCAACGAATTTGCGTTGGCTGCTGCAAGGAACAACGCACTAGCATAGTTGCCGGTGCCACCATACAGAGCTTTTGNNN
NNNTGATCTTGTTCTCCTTAGGCTTATCCGTCT
page-top