Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6697  (registered. 2012)
Contig Information
Length 1246 bp
Clones alternative view 14 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 1
Wh_RDr Root of dessiccated seed 5
Wh_V483 Shoot grown under cold condition for 3days 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125531781|gb|EAY78346.1|| hypothetical protein OsI_33434 [Oryza sativa Indica Group]
Score 541
Evalue 5.00E-152
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6697
GCTAGAAACGCTCTTCGGGCACCTTCATTGCAGACTCTCCTGGATGATATTCCTGTGAGCACTGCACTTTCACATTCTTCATCGTCAGCTGGGGATTCAG
ATGGGAAAACTGGAGATAAGAGCTTAAAAACTCGGAAACTAAAACATGATGTTATTGCTGCCATTGGTGATCTTATTGAGGAGATTGATACATGTTATGA
CCAGATTTCTGAGCAAGCTGTCGAACATATCCACCAAAATGAGGTCATCCTAACTCTAGGTCGTTCTAGAACCGTGAAAGAGTTCCTGTATGCTGCAAAG
GAGAAGAAGCGATCTTTTCGTGTATTTGTTGCTGAAGGTGCTCCAAGATATCAGGGACATGTTCTTGCGAAGGAGCTGGTCGAGAAAGGTGTACAGACTA
CTGTTATAACAGATTCAGCAGTTTTTGCTATGATCTCCCGAGTTAACATGGTTATAGTTGGAGTCCATGCAATAATGGCAAACGGTGGAGTCATTGCACC
AGTAGGTATGAATATGGTTGCTCTTGCTGCTCAAAGGCATGCTGTACCCTTTGTCGTGGTTGCTGGCAGTCATAAGTTATGTCCTTTGTATCCGCACAAC
CCGGAGGTTTTACTGAACGAGCTTAAATCACCATCTGATTTGCTTGACTTTGGCGAGTTCTCAAATTGCATGAACTTCAGTACTCAGGATGGTACTCCTC
TTCTAAATGTTGCCAATCCAACGTTTGACTATGTGCCACCGAAGCTTGTCAGCCTTTTCATCACTGATACTGGCGGGCACAGTCCATCATATATGTACCG
GCTTATTTCGGAGTACTACTCAGCTGATGATTTGGTCGTACGGCAGAAGTCAACATCTTAAAAGAACACAAGGCACGGTGGACTACTCGTGTGTTACCAT
TATTTATATGAAGATAATGTGGGGTCTTGTTGAAGCCCAAATGATGTTGCCACAACCATTGCAGTTCTTCCTTTTGCCTGTATGTAGGGTTGGACGGGGC
TGCTCTCTTCAGTGTAATAGGCTGTTTCCCCCTGGAAGTTCAGTTGTGTAACATCATGCTCCTTGTGATAATTTAATTTTGTGGCTTCTTTTTCTGTGTA
AACGGCTGAGGCAATGAGCGCCAAGCGCAACCGTCTAATCTATATGAATTGTATTAACTGTAGAAGCTAGATACAGTATGTGACGCAGAATGCAGTGTTG
CGGTTTGAAGGAAAGAGTAGAGGGCTGGTTTAGCACAAAAAAAAAA
page-top