Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig13486  (registered. 2003)
Contig Information
Length 771 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_KMP Shoot grown under continuous light 2
Homology (BLAST) Top Hit Os02g0668200 [Oryza sativa (japonica cultivar-group)] >gi|113537216|dbj|BAF09599.1| Os02g0668200 [Oryza sativa (japonica cultivar-group)] >gi|125583194|gb|EAZ24125.1| hypothetical protein OsJ_007608 [Oryza sativa (japonica cultivar-group)]
Score 196
Evalue 4.73929e-17
Total Hit Count 143
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig13486
TTTTTTTTTTGGAAAATATAGCAATTTAAGGATTGAAATTATCGATGTTCAGCAAGCATTTCAGGTACTTGAGTACATGAGAACACATCACAAGAGGCAA
GTAGGACCACACGTACATGTCAAACTGGAAGTAGAACAAATTAAGGACTGAATTTATCAGTGCTCAGCAAGCATTTGAGTACTTGACTACATGAAACATA
CAGATCATTTTTAATATATGGCCGGCAAGACCAAGTGGTAAAGACTGAAATTATCATCGCCCAACAAGCGTCTTGCTGGTACAAGACCAAAAATATCTAT
CATTCTGCCTTGTGTTAGTGCTTCCTGGTAATCGAGCTTCCTGCTGGGAGAGGTTGGACTCTTATAGACTTGATCAGTTCGACCTTTCTCGGGACGGAAG
CCTTCTTTTGCACACAGGAAGCATTTCCATTGAAGCACATTATCTACGACCCTCTGTTGTCTAAGACGCACACCAAATCTGACATTGTGTGCATATGTCC
TGTAAAATTCTAGCACTGAGGCAATGTCATCAAATACCATCCCTACTTTTGGCTTCAATTCCTCGTCACACTGGGGTTTATACAAAGAACCCTCTTGAGA
GAATGATTCTTTTTTTCGGTGTACTGGAGTCATTAATGAGAAGCATTGGGGAATTAATTTCTGCGAATGACGTTGCATCACTGAAATCTTGATTTTGAAC
ATTGTTAACCGATTCCATGGCTGATAGTGCTGGTGCACATGCTGCGATCATTGGAATTGAGGGCTCTCCTA
page-top