Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6687  (registered. 2012)
Contig Information
Length 943 bp
Clones alternative view 88 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 2
Wh_V4816 Shoot grown under cold condition for 16days 4
Wh_VHS Shoot with heat shock treatment 5
Wh_VWD Shoot grown with dessication 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XN Leaves, plant was grown at constant 23Ž 13
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 5
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 17
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 21
WH_XV Leaves, plant was grown at constant 23Ž 6
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 4
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|1657859|gb|AAB18209.1|| chlorophyll a/b-binding protein WCAB precursor [Triticum aestivum]
Score 522
Evalue 2.00E-146
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6687
TTTTTTTTTAAATCTAACAATGCTTTTGCATAAAATTCTCATAATTTACATCATGATAGTACAACTCAGATCACAGGACAACATGCCTTATGGCGAGCAC
AATCCCAAGACACCTTACTTGCCGGGGACAAAGTTGGTGGCGAATGCCCATGCATTGTTGTTGACAGGGTCGGTGATGTGGTCAGCAAGGTTCTCAAGAG
GGCCCTTGCCCGTGACGATAGCTTGGACAAAGAAGCCAAACATTGAGAACATGGCAAGACGACCATTCTTGATCTCCTTCACCTTGAGCTCGGAAAATGC
CTCAGGGTCGTCAGCTAGGCCAAGAGGGTCGAAGCTGCCGCCCGGGTAGAGTGGGTCGACGATCTCACCAAGCGGGCCACCGGCAATACGGTACCCCTCA
ACGGCACCCATGAGCACGACCTGGCATGCCCAAATAGCTAGGATGCTTTGCGCGTGGACGAGGCTGGGGTTGCCAAGATAGTCAAGACCACCCTCACTAA
AGATCTGGGAGCCAGCCTTAAACCAAACGGCCTCACCGAACTTCACGCCATTGCGGGCCAGCAACTCTGGGAAGACACAACCAAGTGCTCCGAGCATGGC
CCAGCGACAGTGGATCACTTCGAGCTCCCGGTTCTTGGCAAAGGTCTCGGGGTCAGCTGAAAGCCCAGCAGTGTCCCACCCATAGTCACCAGGGAACTCA
CCGGTCAGGTAGCTCGGGGGCTCACCAGAGAGTAGGCCGAGGTAGAGCACCCGGTTAGCACCATACCATGGGCTGCCAGAGGAAACCTGCTTAGCCTTCG
CTGCAGTCTTGCGCATGGTCACGCGGGCCTCGCCGAAGAGAGCTGGCGATGGTACATTCTTCACCGCCTTGCCAGCAAAGGTCGAGGAGGAGAGGGACGT
GGTGGTCGCCGCCATTGGAGAGCTAAGAAAAGTGTCTGCTGTA
page-top