Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig13407  (registered. 2003)
Contig Information
Length 1415 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 1
Homology (BLAST) Top Hit N-acetylgalactosamine 6-sulfatase (GALNS) [Lentisphaera araneosa HTCC2155] >gi|149140314|gb|EDM28713.1| N-acetylgalactosamine 6-sulfatase (GALNS) [Lentisphaera araneosa HTCC2155]
Score 81
Evalue 9.68
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig13407
CATTTCTATAATTGCTACAGAGAGGGTGCAGTTCACTACACAAGGTTAATTTTAAGATACCATAAAAAAGGTTAATTTTAAGCATCAGAGCACACAGTTC
GTGCTCTTGAAGTCTTTGAGAGAGATTCTTACATTCATGCTCAACTGCATACTAGTTAGAAGAAACTAATTAGTGCTAGTACATCATAACACGAGTCTTC
CGTTTCCTTTATACATTCTTTATTTTCCGTGCATTTTTCTAGCATTACTAATCATGGAACAGTACAACGAGTGCACGTCAAGCACCATCTGCTAGCATCA
CTTGTTGAAGTACGTGTAGGCCGGGTTCAGTCGCGCAGCAACTCGAACAGGTCCTCTAGGGTACTATCAGCAGCCTGTCCATCTTCCAAGCCAGCCCATT
CTCTCACAACAGCCTCCACTGTTACAAAATTAGCTGCGTACCCCTGCTGCACGTCACCATCTTGTTGCACTCCCACGACACGACCATTTGCAATAACTGG
TCCTCCTGAGCATCCACTCATTGATTTGCAATCATGCCTCATCCTTTCCTTCCAGTCCATTTCTTTTGTTTCCCTGATTTTTGGTCCAACAATGCTTCCA
GGACATGCTCCGGGTTCAATGGGAATAGGATTGTTAGTCTCCTCCAACTTATCGGGAGTGTAGTATGCCACTAACACGGCATCTGTTCCAATCGTTAAAG
TTGTCTCACTGGAAAATATCAAAGCCGGATAATTCTCAGGCATTCCAAACACAGGCGATAATCGCTAGGTCTTTGTTGGTATCCTGGTAGAGTATTTCAC
ACTCGAGCTCCTGGTCTAACCCAGGTGCTCTAATGCCTAGCTTGTCCCCAGGAGGGACAAAATATGCAGCGACATGATTACATGTCATCACAAGAGCTCT
TCTGTTCCCTCGAGCAGCCCTAACGATGAAACCGCTGGCGGCTAATGTCTCCTCCTCCTTCTTCTTCTTTTTGCGGGAATCATCCTTCTTATGTATCACT
ATGCATAGAACACCCTTTCTGTGATTCTTAAGTGTGGTTCGAGTCAAGACCTGACGAGCGTTCATCTTCAACGCTGGGTAAAAGTTAACCTAGCTGCTTG
CTGCCCCGCTCCTTCTCCTCTTCAATTTGTCCTAGGACAAGAATACGTGGCCGGGAACGGAGGGGAGGCGTCGGCAGCAGGTCGACGAACTTGGCGCGAT
CTACTGTCCGAGAGGAAGAAGTGGACGTTGTGGATGGAGTCCTTGAGTGCGCCCTGGCGTCTGAATGGAACCGGGATGGCGCGGGGGTTCTTGTGGGCGA
CGTGGAGGAGGCCGGAGCGCTGCTAAACCGGCGGCGAGCTCCTGCTCGGGGCAGCCATGGCTCCTGGGAGCAGCGAACAGGCGCGAGAGGGGGATCTGTG
GAGAGGCGGCGGCGC
page-top