Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig13319  (registered. 2003)
Contig Information
Length 747 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_RDr Root of dessiccated seed 2
Homology (BLAST) Top Hit probable light-induced protein [Triticum aestivum]
Score 585
Evalue 1.26363e-58
Total Hit Count 349
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig13319
AAAGGACGGCATAACTTTCTTCGACGCAAGGCCGCGTGGTATGCGTTCAATCTGTACACCTTTTTGCACAAAATGCACAAAGATTATTAACCTGCGCGGA
ATTTTCATACCACTCTGCTTTGTTCAAGGGCGTGACTGACAAAGAAATTTCGACATGGGAAAGAATGAAAGACACGGAAATTGAGCCGGTCCGCGGCCCA
GAGTTCCGGGGCAGCAGGCAGGCTATGCAGTCGATTATTAATCCAGTCGGTCCTCGCTACCCTTCCAGTGATGCAGCAGCCACCTCCTTTCCATCATCAG
AGAAGTAGTCTTGCCTTATTTTACGGGAAAGCTGGTACAGGCCTGTGCCGGCCATCGCAACGTTAACGCTGAAAAGGTTCCAGTTTTTCGGTGTGATAAC
CATGCTGTAGCGTGACCAGACGACTCCAGTGCAGGCAACAGCGATTTGCTGAGGATAGGATATCTTTTCTGGAGGCTTAGCAAAGTCGGCAATGTTCGCA
ATGCTGATCCCCCATTTAAATGTTGGAGCCCAAAAATGAATAGTTTTGGGGCCGGCGGGATGGTTCAAGAAGGCTTGAATCTTTGAAGCCATTCAATCAA
ATGGACGCGCACTTTCCTGTCCTTTTGCACAACCCTGCTTAATTACTGTCCTGTACACCTGGGAGGGACGCCCGCCGCCGGTCGCCGGTCGCCGGTCGAG
GTCGAGGTCGCGGTCGCCGGAGCCGAGGGAGCCGAGAGGGCAGATGG
page-top