Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig13307  (registered. 2003)
Contig Information
Length 1475 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit Os03g0395600 [Oryza sativa (japonica cultivar-group)] >gi|113548764|dbj|BAF12207.1| Os03g0395600 [Oryza sativa (japonica cultivar-group)]
Score 1372
Evalue 2.04774e-149
Total Hit Count 190
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig13307
AATGAAGCAACAATAAATAACGGGCACATGCTATAATTACCAAATAAAACATGAATCTCATGCACAGAAAATTGGGCCGAAAGAATATCTGCTCTTAGCT
TGATGGGGCCTGGCTACTTTTTGATGACGATTTGGCAACATAGATCTGCTTCACCCTACCAGTGCCATATTTCTTGTTGGAACCAGAGCTCCTCCCGGGA
TATCCTGACCGACGTTGCCATTCATTCACAGTTCCAGCCCTTTGGGTAACCCTGGCCAGACGATCCTGATTATTATTAACTGAATGCTTGAACTGTTGAT
CCGATGGTAATGAAGACTGGTGTGGCTTGGAGGGCATCTTGGCAACTTGACCAGACTTGGGGTTGCTATTTGGGACTTCATTGCCGATCACACCTTTCCG
GACAAATGAAGGCTCAGCAGTTCGAGCATCTGAACTGCTTGAGGCTGGCTGTTTAACATCCGACGACTGGGAGGCAGCTATACTTGGGAAACTCTTGTTG
CTATCTGATGTTGAGGGCTCCTGGAACCGCTCATTTGTACTTGACTTGTCAATTACCACATTATCAACATACTGTGATGCCACTGTACCATCTATTGGAT
GCGGTTGCAGTTGCACTGATAACGGGACAGAGTGCATAGGCACACGTGGCCAACAAGGTTGCACCTGTATTTTCGCAGATGACTGGAACGAAGCCATGTC
AAACATTGTCAGCGGGGATGGGATTGGCATGATAGAAGTTGCACGTAGATGCGGCACTTGAGTAGGAAAACTGGGTGAGGTTACTTGACCAGGTAGCACA
CTTTGGTTGCTTGGATCACTCTGGCTGATGCCAACAGAAGGTCCTTGGTTTTGCTTCCAATCAGGCTGCTTGTCACCAGGAATGTAAGTGGCTCCCATAA
AACCAAGCCCCATTTGACCAAATTGCCCAAGTGGGGCAAAGTGGTTGTAGACCACCATATGTGGAGGACCTTGCACGCCTGGGATTCCTCCAGGGCTAAT
GAAAGGACCAGCGAATCCAGTAGGGGGACGATAAAATGAATCCACCATAGATGGCCAAGCACCCAACTGTGCTGAAGGCAAAGCGTTGCTTCTTTGAGGC
TGTTGACCCAAAGTGCCGGCAGATTCATCACTTGGCCCAAATGCAAAAGGATGTGCTCCTAACATTGTGTTCATCTCGAAGCAAGAGAAGTGAGACGGCT
GTGCAATGGGGAACTGAGAAAGCGTTGGCCCTGGCACCTGTGGGCTTGGTAAAGAAGGCCACAGGGACATTGACGGAGTGTCAACTGACAGGTCTGCTGG
AAGAGCAACCGTCAGTGGCTCCTCTCCAGATGATTGACCAGGTTGACCTGTTATTGCCCCTCCGGCTGTTAACCGAGTGAGATCCTTACTGCTAAAGCTA
TTTTTGTCTGAAGCAGAAGCTTCAGTTCCAACTGCCTCATCAGTACAAATAGCTGCAACAGCCACAGCAGAAGCA
page-top