Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig13306  (registered. 2003)
Contig Information
Length 832 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Homology (BLAST) Top Hit Os02g0521700 [Oryza sativa (japonica cultivar-group)] >gi|49388919|dbj|BAD26141.1| unknown protein [Oryza sativa Japonica Group] >gi|113536508|dbj|BAF08891.1| Os02g0521700 [Oryza sativa (japonica cultivar-group)] >gi|125539680|gb|EAY86075.1| hypothetical protein OsI_07443 [Oryza sativa Indica Group] >gi|125582321|gb|EAZ23252.1| hypothetical protein OsJ_006735 [Oryza sativa (japonica cultivar-group)] >gi|215693151|dbj|BAG88533.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215697016|dbj|BAG91010.1| unnamed protein product [Oryza sativa Japonica Group]
Score 411
Evalue 2.32756e-38
Total Hit Count 49
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig13306
ACACATCATACATCGCACTGGCTCTGAATCAAGGTTACATATACAAGCCGAACTTGGAGTAGGCGCCCGTTCAGAACATATTTTCTTTATACTTGAAGTC
TGATGACAAGTACTCTTCATCAGAATACAGAATAGAATAGTGGAGTAGGAGCAGGCAGGCAGAGGCATCATCACAAGTTGCTCCTGTGAGTAGTGGCTGC
TGGCTTGGGTGGTGGCGACTTCTTCATGTTACCGAAGAGGGAGTGCCTGCCCTCGGCGACGACGTTGCCGGTGCCGGCGTTGGTGAAGAGCACGTGTGTG
CCGGAGTAGGCGCCCTTGTGTCCGAGCGCCCTTGCCGTTATGCTCAGCCGGTCCCCCGGGCGGGCCTGGGAGAGATCGGGGAAGGCGACGGACATGTCGA
CGGAGACCTTGAGGTTTTGGCCTTCGGAGATGGAGGCGGCGGAGCCGATCTCGTCGACCAGGGCGACAACGGCACCGGCGGCGAGGCAGCCGGTGGTGGA
GTCGGTGAGGCTCGGGGGGACGGTGTAGGAGCAGTGGATGAACCCCGGATGGAGGCGGAGCACGCGGATCCCGCGCAGCGCGAATCCCTCGAAGAAGCTC
GGCGACAGATGAGTAGTGGCCGATGATAGGGATGCGGATGCGGATGCGGCGGAGGAGAGCGCGTCCACCCGCGCGTGCTCGTCGGCGCGCACGCTCAGGA
CGTCCCGAGCACGAGCTAACTCGGGGGAGTCGGCCATGGCCACCTGCTGCAGCTCTGCCTGATGATTATCTTTCTCCGGTGGATTTGGGAATTTGTGACC
GACTGACTCTGGTTGTTGGTGCCACGCGAGCA
page-top