Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig13305  (registered. 2003)
Contig Information
Length 690 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Homology (BLAST) Top Hit Os03g0285100 [Oryza sativa (japonica cultivar-group)] >gi|108707554|gb|ABF95349.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|108707555|gb|ABF95350.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|113548239|dbj|BAF11682.1| Os03g0285100 [Oryza sativa (japonica cultivar-group)] >gi|215701256|dbj|BAG92680.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218192577|gb|EEC75004.1| hypothetical protein OsI_11067 [Oryza sativa Indica Group]
Score 494
Evalue 3.88082e-48
Total Hit Count 24
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig13305
TTCTAGGTGACCCAGTATTTCATGGTTATAATGGAAGATTAAAGAGGATCCAATTGATGTACAGGTGAAGAAAATCACCAAAATGAAGGAGTACTCTATT
ATGATCTATTAGAATGTGCTTGAAGCAATACAGAACCATGATATACTTGGTATAGTACAGACTAAATGTACAATACAGACTTCCAAGTAGAATCTTCGGC
CTACGGCTCACCTGTTATCTGTCACTTCAGCAGTTACTTGGGTGGGACAACCAATGTATAGATTAGCAATGCCGAAACGATGATAATCGCCCCTACCAAG
GTAAATCTTGGACTTGTCCACAACATCAAGTTAGACCTCTCAGCTCTTTTGATTGGATCGACTTCTTCTGACAATGGATACTCACTGCGCCGTGGGTTCC
AGGTCACATATTTGTTCGGTGAGAACTCTGAGAACAGGGTCTTCTTCCCTTTCTTCTTAAAGGTAGACCAAGCCTTATCCCAGTCGGTTGACGATGTGTC
ACCTTCGTCCCTGCCGCGCTTGTCCGGGGAGCCTCGGGAGCAGCGAGGGGCGAGCGCCAGTGGAGGCCGTCGAGCCAAGAATTTCCCGGAAACCAGTAGT
ATCCCCATGGCCCCTCCCCGTTCGAGATTCTGCCGATCAGGAAGGATTCTTTCCCCGCGCGGCCTCTCTGCTAATCGCGGCGGCACGAGG
page-top