Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig13298  (registered. 2003)
Contig Information
Length 809 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_RDr Root of dessiccated seed 2
Homology (BLAST) Top Hit hypothetical protein LOC100194331 [Zea mays] >gi|194695542|gb|ACF81855.1| unknown [Zea mays] >gi|195624594|gb|ACG34127.1| ras-related protein RIC2 [Zea mays] >gi|195643338|gb|ACG41137.1| ras-related protein RIC2 [Zea mays]
Score 692
Evalue 5.77153e-71
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig13298
TTTTTTTTTTGCCGCAAAGACGATACAACAATATGAAGGAAGGTCTCACCTCATCTAGACAAACTTCTCGGTTCAGCAACAAACTTCAACTTCTCTAGGT
AACATCATCATCATAATAATAATACTTGCTACTACTGCTACTAATAATTCCCGGTCGCTGCAAAGGCCACGTCACAAAAGCTCAGCAACAAAAAATACAG
CATGGCGCCTCAGCTAGAGCAGCACCCGCCCTTCTTCACCGCCGAGACATCGTCCTTCATGTTGATCTTCTCACCCTTGCCAGGGCCAGCGGCCGAGTCT
TCACCCGCCTCGACCGCCCTCTTGCTCACGATGCGGTAAATCTGTTTCAAGACCTCCGCAAAAGCGTCCTCAACATTGGTCGACTCGAGCGCAGAGGTCT
CCATGAAATAGAGTGACTCCCTCTCTGCAAAGGCCTTCCCTTCGTCGGTTGGGACGGCCACGAGATGGCGGAGATCAGACTTGTTGCCAACAAGCATGAC
AACTATGTTCGGATCCGTATGGTCCCTCAGTTCCTTCAGCCAGCGCTCTGCATTCTCGAAGGTTGCGTGCCGGGTGACGTCGTAGACAAGCAACGCTCCT
ACAGCACCACGGTAGTATGCGCTAGTAATAGCACGGTACCTGCGGCAGGATTCAGAACAGAAATGAAATGTAGTAAGTTAAGGCAGATGTGAACCGAAAA
GACAACATTGTGAAAAACAAGAGAATTCACTACCGATCAAGAATCCTAAAGTAGTTCACCAAGAGGTTAAAAGTTCGTGGTAACTTTACAATCATGTGCC
TCGTGCCGA
page-top