Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig13227  (registered. 2003)
Contig Information
Length 906 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_OKCS Seed DPA5 1
Wh_SHDr Shoot grown with dessication 2
Homology (BLAST) Top Hit Os05g0153000 [Oryza sativa (japonica cultivar-group)] >gi|113578227|dbj|BAF16590.1| Os05g0153000 [Oryza sativa (japonica cultivar-group)]
Score 486
Evalue 5.43842e-47
Total Hit Count 342
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig13227
CTTTAAAAAATTAAGGTCAAAATTTTACACAAAATACAAAGTGGACTAATAAACTTTACTACCATTACTCCCACTATGGGCAATCTTATGATATTTTCGT
TGTGATTAGCCAAGGACGAGGCGAAATCACGTTCTGTGATGGAGGACTTTGACTGCAGTTCATCCCCTAGGGCAAGCAAATATCGGGCGTATGTTACGGT
ACAGGTACAGGTATCACTTATCCTCCTCCGGTGTGCACCGGGGAGCTCTGCTCACCGTCGTCGACCAGGACTCCCTATGGCCGTAGGGGAGGGGAGATGT
GCGGCCGCTGTCCCCGGTGCGTGCAGCGAGGAAGGGAAAAGCCGCCGTGCCGTGGCTGGCATCGACGGCGACGACGACCCTCGGCTCTTGAGAGACCAGG
AAGGTGTTGCCGGCGACGGCGACGCTGCGGATGAAGATGGTGGCAGTCTCTCCCTAGCGGTCCTCCCGGCAGAGGCAGAACCGAACGTCCTCCTCGCCGC
CGGCTGCTGCTGCTGCTGCTGCTCCGGCGTCGTCGGCTCTGACGACATCCCCTGTCTTCGCGACGAAGACTTGCGCAAGCTCCTGTCCGGTGACTCCAAT
TTTGGTGAAAGCCCTTTCAGCATTGCCAGCTTCCTCTCAAATGAGTTGCCCAGCATAGCTGCAGCTTGTTTTGAGCTATCCCAATTGAAGAAGCTGGTGA
AAAATGCAGGTTCATCCCCTTCCGCGACAGCATACACGGTTGTCTCAGTGACCGACCGTGGTCCATCCCGAGCAATGCCTGCCTGAAGGAACATCTTGCC
GAAGTCGAGGGCGTGCTCCTTGGACGTGACACCTGAGTGAAGTCCAACCCAGACGTAGATTTCTTCGCCGCAGTCCAGTATCAAGGTCTCCTCCGTTGCC
AGATCA
page-top