Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig13220  (registered. 2003)
Contig Information
Length 738 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VABA Shoot with ABA treatment 2
Homology (BLAST) Top Hit hypothetical protein OsI_17208 [Oryza sativa Indica Group]
Score 440
Evalue 8.12493e-42
Total Hit Count 435
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig13220
CGAGGGAGCCATGGAAGGGGGGAGCCTCTGGCACGAGTTCGAGACGGACCTCCCGGCCGCTGACGTGTGGGAGGTCTATGGCAGCCTCGCTCTCGGGCAA
CTAGTCCCCCAGTTGCTCCCACAGGTCCTCTCAAAGGTCGAGCTTGTAGAGGGAGACGGCGGCGCCGGAACAGTCCTGCTCGTCACTTTCCCTCCTGCAG
GAGCTTCCGAACCAAGAAGCTACAAGGAGAAGTTCAACGTAGTCGACGATGAGAAGTACATCAAGGAGGCAGAAACGGTGGAGGGAGGCTTTCTGGATCT
CGGCTTCCGGAAATATGTGGTGCGATTCGAGGTCGTTGGGAAGGAAGATGGCACGTCGGTTATAAGATCGACCGTCGAGTATGAGGTTGATGCCGAGCAT
GCCAAGAATGCCTCCCTTGTCAGCACAGAAGCAGTGGCCTCTATTGCTGAGGCCATCACCAAGCACATCAAGGAGCAGAAGAAGAGCCCCGAGCAAACCC
CCGAGTAAAATTCAGAAGAACTTGCATGTGCCTGGATAAGAGTCGGGAAGACGAAGTGTCCAACTGAAGTGACTGTGGCAGCCAAGTTGGAGCAAATTCC
CCTGTACCATTTTGTTCTATATATGCAGTGCTCATGCCTTTGGAATTGATGTTTGTATGTTTTAGATTATACACTAGTTTCTACCTGTCAACATGTACAA
AATCTGTACGAATATTGTANTTTAACACAAAAAAAAAA
page-top