Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig13198  (registered. 2003)
Contig Information
Length 1012 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_OKCS Seed DPA5 1
Wh_VSCB Liquid cultured tissue 3
Homology (BLAST) Top Hit hypothetical protein OsJ_015493 [Oryza sativa (japonica cultivar-group)]
Score 1416
Evalue 9.47053e-155
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig13198
CGACATTTTAATCGACAGCTCCGCGGAAAGGGGGTGTCATATCTGAATTACAAGTCATTATACGAAGTGGCAGCAGCTAGAATGGCAGCAACGAATCGGT
GGTTTTTGCTAAACAAGTGGCGGCATGTACTGAAGCCAGGGTGCTGCTAACTCAGCACCCCATTATTGCACAGTTGTAGACGAAGACGCCGGCGCGCTCC
TTCACCGAGAGCACCTCCCAGTCGGCGGCGGCGCCGGCGCCGTTCCCATCTTCGGGGCACCAGGAATGCAGCAGTATCACCTCGCCGCGAGGTCCCCTGT
GGCCGCCGATGACCAGCAGCCTGTCGCCGCATCCCTTGAAAGCCAGGCCCCAGCCGTTGGAAGAGTCCGCTCTGACGGGCAAGGGCTTCACTATGTTCCA
TGTGTTGCTTGCCTTGTCGTACTTCTTCACCACGTTTGTGGACTGGTCAGCCGCGTAGAGCTGGTTATTTACAACGGCGATGAGCGGAGGCGACTGGGAG
GCGCTGGTGCCTCCGGGGTACATATTATGTATTCTTCTCCATGTCCTGGTGTCGAGATCGAATTCCTCTCCACAAGTCAGAGAATGCCTCTCACTTGTCA
CACCCCCGATGACATAGAACTTGCCATCCATGAAGAAACCTGAGGAGAGTCTCCGCGGCAAGTTCATGTCTGGCAAGGTCTCCCACTGCCCAGCCTCTGA
ATTGTACAGCTCCACAGATCTCAGCACCTGCCCGTCCCTATCACACCCACCAGCAACAATGGCAATCTCACCAGAGCTTCCCGAGGCAAACAGGCAGCGA
GGAAGATTCATCGGAGTGCAGCGAGACCAATGGCGTGTCAGTAGATTGTACATCCAAATAGCAAGGCCTGTATATTCTCGGCCAAAGACAAGCAGCTGTG
TCCCAACAGCAAGTGACTCCTTGTCTGCACAGGAGAAGCAGTCATCACATGGCATTCTCGGGAGCCTCATCCACCGGTTTCGCGACGGATCGAATGCTTC
CCAGGGCATAGC
page-top