Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig13107  (registered. 2003)
Contig Information
Length 828 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_EM Dormant seed with water absorption 2
Wh_SHC Shoot grown with cold treatment 1
Homology (BLAST) Top Hit unnamed protein product [Oryza sativa Japonica Group]
Score 582
Evalue 3.42981e-58
Total Hit Count 386
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig13107
AACTGAAGAGTTTTTGTCAGCGGTATTAGTAAACAAACAATGTGAGAGGAGTGACCAAGCAGCTCGCGGAAAACATACAAGGTACAGAAAAGCAAAGCTC
AACATAACCGGTGGGCGGTCGGAATTTCAGGACCAATTACAACATCATCACTGTCGCCACGGCGGTGCCAGGGGGCCGAGCCACAGAAGTGTTGCGCCGG
AGACTCCAGGTATACGACGCCAGTCCCTTTTGTGTTCCCTATCAGAGTGCTGGAAACATCTGACGAGAACAACACACATTGAGGGTTATGGATGATGATT
AGTTACCTTGTAGTAGACCAAACAGACAGCAGCAGCAGCAAAAGCAGAGAGAACATATTCCTACTTCATAGACAACACGGGGGGCGACTCCGGGACATTG
CGGGAGTAGCCAGCTTTGATCTACTTGAGACTAGCCTTCCAAGCATACACAACTAACCTGCCACGAGCCTTTCTGGTCTCAAACTAACGAGCTCGCCAGA
GAGAGTTCATGTATTTCAGTCAGCGTCCACTCCTCTCCAGTTTGTCCTCCAAGAACTATTGCCTTTGATCCTTCCATGACACATGTACTGTGTCCCCATG
CAAACCTCGGAGGTCGCCCTGGGACGTTCAGTATTCTCCAGGTGGGTTTCTCTTCGGTCGGATCCAGGAGGTAGAGCTGTGAAGCAGAGTGAAGACCTGC
TACTGAGCCACCAAATATCATAATTCTCCCTCCGGGTAGGCTCACAGCAACATGATCAAGGCGAGGAGGCGGACCAACCCCAGCGGGGTTACAGGCTCCT
GGCATTCCACTACCGGTGATGCACCGCC
page-top