Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6652  (registered. 2012)
Contig Information
Length 813 bp
Clones alternative view 202 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_SH - 6
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 7
Wh_PCDAM Anther at meiosis 3
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 11
Wh_V483 Shoot grown under cold condition for 3days 25
Wh_VABA Shoot with ABA treatment 3
Wh_VHS Shoot with heat shock treatment 27
Wh_VWD Shoot grown with dessication 7
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 6
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 6
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 10
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 15
WH_XE Seedling, infected with leaf rust 6
WH_XF Seedling, infected with leaf rust 24
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 20
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 12
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|132099|sp|P26667.1|RBS2_WHEAT|RBS2_WHEAT RecName: Full=Ribulose bisphosphate carboxylase small chain PW9,"
Score 355
Evalue 3.00E-96
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6652
GCACGAGGCTCCCCACCTAGCAATTCACGTGCCATGGCCCCAGCCGTGATGGCATCGTCCGCCACCACCGTCGCGCCCTTCCAGGGGCTCAAGTCGACCG
CCGGCCTCCCCGTCAGCCGCCGCTCCGGCAGCGCCGGTCTCAGCAGCGTCAGCAATGGCGGAAGGATCAGATGCATGCAGGTGTGGCCGATTGAGGGCAT
CAAGAAGTTCGAGACCCTGTCTTACTTGCCACCCCTCTCCACGGAGGCCCTCCTAAAGCAGGTCGACTACCTGATCCGCTCCAAGTGGGTGCCCTGCCTC
GAGTTCAGCAAGGTTGGCTTCGTCTTCCGTGAGCACAACAGCTCCCCCGGCTACTACGACGGTCGATACTGGACAATGTGGAAGCTGCCTATGTTCGGGT
GCACCGACGCAACGCAAGTGCTCAGCGAGGTGGAGGAGGTCAAGAAGGAGTACCCTGATGCCTATGTCCGCGTCATCGGCTTCGACAACATGCGCCAGGT
GCAGTGCGTCAGCTTCATTGCCTTCAGGCCACCAGGCTGCGAGGAATCTGGCAAGGCCTAAAGTGCAAGTTGAAGTAACGCATATACATGCCATGTTAGT
TCACATTTGTCGGCAGCTCTGCTTTCTCGGTTTTACTTCTCGTACTACTCGTATGTGAATATATGAGCATATGTATGTAAGCACCTACCAACGTAGGTCG
AGGAGGATGCATATGAGAATTATAGCACCGGCTATACATACACACATATATTATATGCAATCCGCGGATTATTGTCTTGCCATCGGTTGATGGAAATGTT
ACTTTGTTTGCAG
page-top