Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig13048  (registered. 2003)
Contig Information
Length 1009 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_PCDAM Anther at meiosis 2
Homology (BLAST) Top Hit expressed protein [Oryza sativa (japonica cultivar-group)] >gi|215692397|dbj|BAG87817.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215766576|dbj|BAG98735.1| unnamed protein product [Oryza sativa Japonica Group]
Score 265
Evalue 2.7424e-21
Total Hit Count 20
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig13048
GTCATTAGCAGAGGTACACTTGATTCCAACTTAAACAGCCAACAGATCTTATAGTAGTATAGAAACCCACATCTAGAACTGGTTACTATTGTACTGTATG
TGGCACGCTTGTGTATATACATTTAGACGGCTAAATTGTTTGTTGCGACTGCTCCATAAGGCAATCTGAAATTATACACTCCGGCAGGAATTTAAACTGA
TCGGTCTCAACAAACCCAGATCGACTTGCCATCCATGGTCTCGCCTCATCCCCAGTCTTGTCTTGTCACTTGCCCTTAATTTCTCCTCTCCCTGTGGCTA
ATGACCCGCGACAACTGAGGGATGCAGCACCGCCCAGCTCTGCCTCCGCCGCGAGCCCCGGAGATGTCGCCGGCGCCATCGGCGCTTTCTTGCTTCTCCT
TAAGGAGGTCACCGAGCTTCTTCGTCTGTGGGGCTGGCTTCAGGGGATCGGATTTGAGGATCGCCTCCAGCGTGGGCAGCTTTGTCCGAGGTTCAAATGC
AGCAGCTGTGGCCTGGTTGCTTGCAGTTGTGCTGAATGTTCTCGCAGGTGTACCATCTCCATTTACACTGAAGAAATCGTCTTCACAGTCCGAGTCTAAC
CAAGGAGAGGCTTCGTAGAAAGCTTCATCTCTGCTGCTACCATAGCCAGCGATTGTAGCCGATTCAGCCGGGAGGACGTTCTCAGGCGCCACTTGCCTGC
TATTGGAGCCACCCCCGCTTCCACCATCAACATCTCCGGTAGATTGCAACGGGGCCGACGAGCCCTTCTTCGCCCTTGAACGCTTGCCCCTGCGGATCAA
CTTCATGCCCCCCCAGCTCCTGCTCCACTTTGCAAGGTCAAACAAACATGTAGCATGGGTATTCAGAGTTGACACGAGCTAGAGATCTGACGCAACGTGC
AGAGTCAGCGGGAGATGATTTGTTTTAGGGGGGAAGCAGAGTGGACTGTGGCTTCCAGTGTGGACATCTAGAGGCAAAGCAGCATGATATACGGATCTGG
CTTGGGGTT
page-top