Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig13042  (registered. 2003)
Contig Information
Length 530 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_VABA Shoot with ABA treatment 2
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195604176|gb|ACG23918.1| ubiquinol-cytochrome c reductase complex ubiquinone-binding protein QP-C [Zea mays] >gi|195607900|gb|ACG25780.1| ubiquinol-cytochrome c reductase complex ubiquinone-binding protein QP-C [Zea mays] >gi|195611162|gb|ACG27411.1| ubiquinol-cytochrome c reductase complex ubiquinone-binding protein QP-C [Zea mays] >gi|195617026|gb|ACG30343.1| ubiquinol-cytochrome c reductase complex ubiquinone-binding protein QP-C [Zea mays] >gi|195618116|gb|ACG30888.1| ubiquinol-cytochrome c reductase complex ubiquinone-binding protein QP-C [Zea mays] >gi|195621702|gb|ACG32681.1| ubiquinol-cytochrome c reductase complex ubiquinone-binding protein QP-C [Zea mays]
Score 363
Evalue 3.09464e-33
Total Hit Count 25
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig13042
TTTTTTTTTTGACGAGTTAATTTGCTTTATTCAACAATTACTCCAACGATGGATAGCACAACATTTGAGCCTCAAAGTAAGTTTGCAAGTCGCACTTACT
GCATCATTGCATATGCATGGAAAGAGGAAAAGAGTACAACTAGGAAATGATTCCAAAAATGTTAAATCACTCTTGGCGGATTATAGAACATGGAAATTCC
AACTGCTTTGACATTTGACAAAGCTTCACATCTAGTATCTGTGGGACAGCTTCTCCTGCTCCTTGTAGTACATCGCGTACTGGTAGGTGCCGACGACGGG
GGTGATGAGGAGCGTGGCGGAGATCCAGTTCTCGGACACCTTGTGGTGGATCTTGGTGGTGATGTCCTTCCACAGGCCCGGCATCACCTGCTGCTGGAAC
GGCGACAGCGCGTACACCACCGCCTTCATCCGCACCGGCATCTTCCCCATCTTTCTCCTCGCCGCGCCTCGCCGCGCCGCTTCTCCTTCTTCCTCGGGTC
TCCTCCGGCTCCGATTTACCTCAGGACGAT
page-top