Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6642  (registered. 2012)
Contig Information
Length 759 bp
Clones alternative view 31 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 5
Wh_KMP Shoot grown under continuous light 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 3
WH_XF Seedling, infected with leaf rust 1
WH_XV Leaves, plant was grown at constant 23℃ 3
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 12
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|86439724|emb|CAJ19340.1|| photosystem 1 subunit 5 [Triticum aestivum]
Score 376
Evalue 1.00E-102
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6642
TTTTTTTTTTGGTCTGCGGATCTGGATGTAATTTTTATTATTTCTGATATCCGTTGTATTGCCATGATTGAAGATGAAAACACGAATCATTCATGTGGCA
CTGAATACACACACGCGGTTGCACTACTTGTCCAGATTAATCTTTCACCATCTCACATACATACAAACATGATAGTACATCATCAGCGTATAGAGAACTA
ATGAAAACACGGCGGATTACAACAGCAAGCCGGTCCGGTCGGCACGCAGGCAGGCAGACATGGGAGGGATCAGCCGAAGAAGGGTGGGTCGTATCCGTTG
CTGGTGGTGGCGAGGATGTAGTAGGCGACGATGTGGCCGATGGAGCCCCAGGCGAGGACGTCGACGAGGTTGAAGCCGACGGGGTCGTTGGACTTGAGGA
TGCCCGCGAACTCCTTGGCGCGCTCGTCGCCGGCCTCGAAGTGGGTCTTGCCGTTCTGCTCGGGGACCTGCTTCGCCACGTTCTCCCGCTGGAAGTTGAA
GAAGACGAAGCGGCCCATCACCAGCGACAGCCCCGTGCTGAGGCTGATCACCACCGACGGCTCCAGCGCCGCCCGCGCCGCCACGGACCGCCTCGCCGGC
GCCCGGAACGAGACGGCCGCCCGCGGGGACGGCGCCAGGCGGAGCCCGGCCACGGTGGGCGGGGACAGCACGGCGGCGGTCGAGGTGGCCATGGTCCTCT
CTCCCTCGGATCTGTGTGGGTGGTCAAGAACCAACGTGCGGCGAGTTCTCTCTCCCCGG
page-top