Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig12956  (registered. 2003)
Contig Information
Length 830 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Homology (BLAST) Top Hit Os03g0364000 [Oryza sativa (japonica cultivar-group)] >gi|113548641|dbj|BAF12084.1| Os03g0364000 [Oryza sativa (japonica cultivar-group)]
Score 371
Evalue 1.01196e-33
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig12956
CGCTTTCAGCCACGCAACGATCCACTGCCTCGCTCCCGGCCCCGCGCCTCCGCCGTCCTCGCTCGCCCCGCCGACTCCGGCCGGATACGCCGGCCCGCTC
CCGGATCGGACAGGCTTGCAAGCATGTATATTCGAGTCAAGCGGAACAAGACCACCTACTTCATACAGTGTGATCCAACAGAGACAATTTTGAATATCAA
GCAGAAGCTGCAGTCAATAACAGACCACCCTCCTAATAACCAGAGGTTGATCTTGTTGGCTACCAACAATATATTGGATGACTCCAAGACGCTTGCTGAT
CAAAAGGTGGAGAATGACGCCGTCGTTGCATTGGCATTGAGAAAAGACAACGAGTTCGAGGAGGTGTCCATCGCCGACCCAAGCGATTACATGGCGTCCT
CATGAGGCCGGCCGGTCCGTCGCCGTCCCTCCTACCCAATCCATGCAAGGACACTGGTGGCTTCCGTGAAGCAGATCATGTTACTTGCTTGCTCTAGCCT
CTAGCCTATAGGATGTTGCTCACTTGTGTGATTGTGTCCTTGCTATTAAAGACCCTAAACAACCGTTGCGGATGGCATTTAGTTTGGATTTGGACCCTCC
AGCCGATACGTGTGATGTGTGATCTCACCACCCACCGGGGCGTGTCCTGGTGCTCCGACCTACCCGTCTTTTGTACCGGCGCGTGAATGAGCACGGACAT
GGGTGGCGAGATCCGTTGGTGGTGACCGGTGATTGGGATCCCTTCCCACCACCTAATGCTGCGTGTCATGCAGGTCCTGTTGTGTTTGCCAGTTGGTGTG
TGCTGCTAGGGACTATATGTCGTCTGCTGG
page-top