Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig12907  (registered. 2003)
Contig Information
Length 575 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_KMP Shoot grown under continuous light 2
Homology (BLAST) Top Hit RecName: Full=Defender against cell death 2; Short=DAD-2 >gi|5918185|emb|CAB56224.1| defender against death (dad) 2 [Hordeum vulgare]
Score 559
Evalue 7.3846e-56
Total Hit Count 172
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig12907
CTCACCTCTGCATCTTCGCGTCGTCGTCTTCACAGCACAGCTCGAAGCTCGCGGGGAAGCAAGGATGCCGAAGCCCGCGGGGGACGCCAAGCTCCTGATC
CAGTCCCTGAACAAGGCCTACGCCGCCACGCCCACGAATCTCAAGATCATTGACCTGTACGTGGTTTTCGCCGTCGCAACTGCCCTGGTTCAGGTCGTTT
ACATGGGAATAGTTGGGTCATTCCCCTTCAACTCTTTCCTGTCTGGTGTCCTGTCATGCATTGGAACTGCAGTGCTTGGTGTTTGCCTCCGTATCCAAGT
CAACAAGGACAACAAGGAATTCAAGGATCTTCCCCCGGAAAGAGCCTTTGCTGATTTCGTCCTGTGCAATCTGGTGCTCCACCTGGTGATCATGAACTTC
CTCGGATGAGCAACTGTCATACAAGCTGTCGAGACTTTGTAGCGTCCTAATGTCTAAGACTGTCAGCATGTTAGATATTCATGTGGCATCATACACAGCT
ATGTAATCCGAGAGTTTCTCTATGAACTATAAGAATTCAGTGGATTTAGCGTTAACTTTGTGGAACATGACAACT
page-top