Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig662  (registered. 2012)
Contig Information
Length 579 bp
Clones alternative view 61 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_oh Pistil at heading date 2
Wh_DPA20 Seed DPA20 5
Wh_EM Dormant seed with water absorption 2
Wh_MS Seed DPA5 of DT3DL CS wheat 5
Wh_SHDr Shoot grown with dessication 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23 4
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 8
WH_XD Root, treated at 50 microM Al for 6h 5
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 8
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig662
TTTTTTTTTTAGCTCAAATTGGGTTATTTATCATAGGCTCTTTGTTGCAAACAAATAGATTGCTTCAACATGCAAATGCGACTGAAAACAGTGACCAGAG
ACAAACTTGTCCGTTTAATATGTATAAGATTGATAACTCTTACAGTTCTTACAACATCAGCTGAAACTGGGTACTTTTAAGTAAGACAAACTATGACGAC
ATCAAACGAATTTAGCTGCAACTGTATTAATGTATGACGGCGTTCAGGCCATCCCACCACTGCTCGCTGTCCTGATTATCTGAAACAGAGATGATCCGAC
GACCACAAAGATGAAGAATCCAAGCACTATAGGTCCAACAGGATAGTCATTCCCCTTCTTCACAGTGGTTTCAGGCACCGAACCCCTCTTGGTGATGTTC
TTCTGGAACTTCGCTGTCTTCCTGTCAGCAAGGCGCCTGGAAGTAGTCATCTTGGCTTCGGGCTGTGTCCGGTGAGCTCGCCGGCGAGGAATGGGAGCTG
GTGCAGCCGGGGGTTAGTTTGGACTCGGTGTTGTGATTTGGCCAATTTGAGGCGAGACGAGGGGCTTTATACCTCGTGC
page-top