Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6617  (registered. 2012)
Contig Information
Length 3755 bp
Clones alternative view 353 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_f Spike at flowering date 4
Wh_h Spike at heading date 4
Wh_yd Spikelet at late flowering 3
Wh_DPA20 Seed DPA20 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 5
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 11
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 1
Wh_V4816 Shoot grown under cold condition for 16days 4
Wh_V483 Shoot grown under cold condition for 3days 6
Wh_VABA Shoot with ABA treatment 9
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 24
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 6
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 19
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 12
WH_XN Leaves, plant was grown at constant 23Ž 12
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 59
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 56
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XT Roots, 18 day old plants were grown hydroponically 6
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 2
WH_XB Root 4
WH_XE Seedling, infected with leaf rust 3
WH_XF Seedling, infected with leaf rust 21
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 16
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 22
WH_XV Leaves, plant was grown at constant 23Ž 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 4
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 11
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|1170029|sp|P18492.3|GSA_HORVU|GSA_HORVU RecName: Full=Glutamate-1-semialdehyde 2,1-aminomutase,"
Score 909
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6617
TACTTCTCAGGGATAACCGGCTTGATGACATGCTCCTTGAGGTCCGCAGCAATCTCATCATTGGTGACAGTCTCATCATGCTGGGTGGAGATCAGAACAG
TGTGCACACGTACAGGAACCATGGCACCTCCCTCGTTGAGGTATTCAACCGTGACCTGGGTTTTGCCATCAGGCCTTAGCCAGGCACAAGTGCCATTCTT
GCGGACTTCAGTGAGGCGGGCACCCAGCTTGGTGGCAAGCACATGGCTGAGGGGCATGAGCTCAGGGGTCTCATCGGTGGCATAGCCAAACATGATACCC
TGGTCACCAGCACCAATATCCTCAGGGCGCTTGGTGAAATGTCCGTGCACACCCTGGGCAATGTCAGGAGACTGCTGCTCTATGTTGACAAGCACCTTGC
ACCGGTCAGCATCAAGGCCAACATCATCAGAGATGAAGCCAATGTTGCGGCAGGTGTCACGCACAATCTTCTCATAGTCAACAGTGGCCTTGGTGGTGAT
CTCACCAAAAACCATGACCATGTTGGTCTTGGTGCATGTCTCACAGGCAACCTTGCTGTCAGCGTCTTGGGCGAGGCACGCGTCAAGCACAGCGTCAGAG
ACCTGGTCGCAGAGCTTGTCAGGGTGGCCCTCGTTCACAGACTCAGAGGTGAAGAGGAAAGTCTCGGCCGCCATTTCTTGAGTGGTGGTGGTGATACTCC
AATCTACCTCTTGCGCTGCCGTTCGATCCTGGCTCAGGATGAACGCTGGCGGCATGCTTAACACATGCAAGTCGAACGGGAAGTGGTGTTTCCAGTGGCG
AACGGGTGAGTAACGCGTAAGAACCTGCCCTTGGGAGGGGAACAACAACTGGAAACGGTTGCTAATACCCCGTAGGCTGAGGAGCAAAAGGAGAAATCCG
CCCAAGGAGGGGCTCGCGTCTGATTAGCTAGTTGGTGAGGTAATAGCTTACCAAGGCGATGATCAGTAGCTGGTCCGAGAGGATGATCAGCCACACTGGG
ACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTGGGGAATTTTCCGCAATGGGCGAAAGCCTGACGGAGCAATGCCGCGTGGAGGTGGAAGGCCT
ACGGGTCGTCAACTTCTTTTCTCGGAGAAGAAACAATGACGGTATCTGAGGAATAAGCATCGGCTAACTCTGTGCCAGCAGCCGCGGTAAGACAGAGGAT
GCAAGCGTTATCCGGAATGATTGGGCGTAAAGCGTCTGTAGGTGGCTTTTCAAGTCCGCCGTCAAATCCCAGGGCTCAACCCTGGACAGGCGGTGGAAAC
TACCAAGCTGGAGTACGGTAGGGGCAGAGGGAATTTCCGGTGGAGCGGTGAAATGCATTGAGATCGGAAAGAACACCAACGGCGAAAGCACTCTGCTGGG
CCGACACTGACACTGAGAGACGAAAGCTAGGGGAGCAAATGGGATTAGAGACCCCAGTAGTCCTAGCCGTAAACGATGGATACTAGGTGCTGTGCGACTC
GACCCGTGCAGTGCTGTAGCTAACGCGTTAAGTATCCCGCCTGGGGAGTACGTTCGCAAGAATGAAACTCAAAGGAATTGACGGGGGCCCGCACAAGCGG
TGGAGCATGTGGTTTAATTCGATACAAAGCGAAGAACCTTACCAGGGCTTGACATGCCGCGAATCCTCTTGAAAGAGAGGGGTGCCCTCGGGAACGCGGA
CACAGGTGGTGCATGGCTGTCGTCAGCTCGTGCCGTAAGGTGTTGGGTTAAGTCTCGCAACGAGCGCAACCCTCGTGTTTAGTTGCCACTATGAGTTTGG
AACCCTGAACAGACCGCCGGTGTTAAGCCGGAGGAAGGAGAGGATGAGGCCAAGTCATCATGCCCCTTATGCCCTGGGCGACACACGTGCTACAATGGGC
GGGACAAAGGGTCGCGATCTCGCGAGGGTGAGCTAACTCCAAAAACCCGTCCTCAGTTCGGATTGCAGGCTGCAACTCGCCTGCATGAAGCAGGAATCGC
TAGTAATCGCCGGTCAGCCATACGGCGGTGAATCCGTTCCCGGGCCTTGTACACACCGCCCGTCACACTATAGGAGCTGGCCATGTTTGAAGTCATTACC
CTTAACCGTAAGGAGGGGGATCATGGCCGGAGCAGCAGCAGCCGCCGCCGCCGTGGCGTCCGGCATCTCGATCCGGCCGGTCGCCGCGCCTAAGATCTCG
CGCGCGCCTCGCTCTCGGTCGGCGGTGAGGGCGGCCGTCTCCATAGGCGAGAAGGCTTACACGGTTCAGAAATCTGAGGAGATCTTCAACGCCGCCAAGG
AATTGATGCCTGGAGGTGTTAATTCACCAGTCCGTGCCTTCAAATCAGTCGGTGGGCAGCCCATAGTTTTTGATTCTGTGAAGGGCTCTCATATGTGGGA
TGTGGATGGAAATGAATATATTGATTATGTTGGTTCCTGGGGTCCTGCAATCATTGGTCATGCAGATGATGAGGTGAATGCTGCACTTATTGAAACTCTG
AAGAAGGGAACTAGCTTTGGTGCTCCATGTGCGTTGGAGAATGTGTTGGCTCAAATGGTCATCTCCGCTGTGCCGAGTATCGAAATGGTTCGTTTTGTAA
ATTCAGGAACAGAAGCTTGCATGGGAGCACTCCGCCTTGTGCGTGCATTCACTGGGAGGGAAAAGATCCTCAAGTTTGAAGGCTGTTACCATGGCCATGC
AGATTCCTTCCTCGTTAAAGCAGGCAGTGGTGTTGCCACCCTCGGCCTCCCAGACTCCCCTGGAGTGCCTAAGGGAGCCACCGTTGGGACTCTAACAGCA
CCTTATAATGATGTTGAGGCAGTTAAAAAGCTGTTTGAGGATAACAAAGGGGAGATTGCTGCAGTCTTCCTTGAGCCGGTTGTCGGCAATGCTGGCTTCA
TTCCTCCGCAGCCTGCTTTCCTAAATGCTCTCCGTGAGGTGACCAAACAAGACGGTGCACTTCTGGTCTTTGATGAAGTGATGACTGGTTTCCGTTTAGC
TTATGGTGGGGCACAAGAGTACTTTGGAATCACCCCTGACGTGACAACCTTGGGGAAAATTATTGGCGGTGGTCTTCCAGTTGGTGCTTACGGTGGGCGG
AAGGAAATCATGGAGATGGTTGCTCCAGCAGGGCCAATGTACCAGGCAGGAACCCTGAGTGGAAACCCTCTAGCTATGACTGCCGGAATCCACACTCTCA
AGCGTCTGATGGAGCCTGGCACCTATGAATACTTGGACAAGGTCACCGGTGAACTTGTCCAGGGGATATTGGATGCGGGCGCTAAAACAGGGCATGAGAT
GTGTGGAGGACACATCAGGGGCATGTTCGGATTCTTCTTCGCAGGTGGCCCAGTGCACAACTTTGATGACGCCAAGAAGAGCGACACCGCGAAGTTTGGG
AGGTTCCACCGTGGGATGCTGGAAGAAGGCGTGTATCTGGCACCGTCCCAGTTCGAGGCAGGTTTTACAAGCTTGGCACACACAACCCTAGACATTGAGA
AAACCGTGGAGGCTGCCGAGAAAGTTCTTCGACGGATATAGACAATTCGGATTGCAAACCTTTTGGAGCTTTTCCTTCTGTTGTACTCTCTTAGTTGTAC
GTGGCTGAAGTTTAGTTTTGTATTGTATTTTGTTGTGCAGCAGCAGAAGCAGCAGTATATTGTCTCTAGACCATTTCTTTTCTTCTGAATTAGCATTTGG
GGTGATTTTGTCTTGGCAATAAAACTTCGGCTACGACCTCAATTTAAAAAAAAAA
page-top