Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig12732  (registered. 2003)
Contig Information
Length 626 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 4
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195628632|gb|ACG36146.1| remorin [Zea mays]
Score 219
Evalue 2.40442e-16
Total Hit Count 211
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig12732
GAGAAGAGGAACTCTTTAATTAAAGCATGGGAGGAGAATGAGAAGACAAAGGCTGAGAACAAGGCTACTAAAAAGGTATCTGCTATTCTCTCATGGGAGA
ACACCAAGAAAGCAAACATAGAAGCTCAACTGAAGAAGATTGAGGAGCAATTGGAAAAGAAGAAGGCGGAATACGCAGAGAAGATGAAGAACAAGGCTGC
AATGATCCACAAGGAGGCCGAAGAGAAGAGAGCGATGGTCGAGGCAAAGAAAGGGGAGGAACTCCTCAAGGCCGAGGAGATGGCCGCCAAGTACCGCGCC
ACCGGCCACTCTCCCAAGAAAGTCATGGGATGCTTCGGGGCCTGAAGCAAAAAACGTTCCTAGTTCGCAAATGGAGCAAGAGTGAATGAAGTGTTCATCC
GTGGTTGCTTGCTTGCTTCCTTGTTTCTTTCATCCCTCCCAAGTGTGTAGTGTGCCTTGTGTGTAAAGTCTGCCGTCTCTGTATATACACATTGCTCCCA
GGACAGGTGCTCGGTTGTGTACATCTTTGATGCTTGACAAGCAACATTCTTATGTGTAGTTAAGAAAGCCACATTTGTTATTATTGTTGACATTAAAGCA
GTCGTTTTTTGGTCTCAAAAAAAAAA
page-top