Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig12687  (registered. 2003)
Contig Information
Length 879 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_OKCS Seed DPA5 1
Wh_RDr Root of dessiccated seed 1
Homology (BLAST) Top Hit sucrose-6F-phosphate phosphohydrolase SPP3 [Triticum aestivum]
Score 1175
Evalue 6.56595e-127
Total Hit Count 88
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig12687
TTTTTTTTTTGCTTTAGTTTAGCCTCTCATGACATGACAGCTAAGCATTAGGCAAAGGCATCAAGATGCCTCCGTAAACATCATCATCAGTCCAGTATAT
GCGTCTGGGAGCACTTATTAACAACATTATGAACAAGTAAAAGAAATTCGCGTGCTTTCGGTACACGATTTCTTATTTGATCCTCAACAAGAAAACCTCC
TTCCCATGCGCCTCCAGTCTAGAGTTTGGATGACTGCTCGACCCCGGGATATTCTTTACGCCACGTCTTGTGAATGTGTGTTACCACAAAACCCCCAGGG
GATTCAGGCTTTACATTCAGCGCAAGAGTTGTAAAACAGCACACCCACGCAGCACCTTCTGCCTCCCACAAGTCGAATCTCACAAGCCAACTGTCAGAAG
CAGTCTGCAAGATAACTAGTCTGTCCACCCATGATCGGTACTTTTTCCCTTGTTTGTCACCATAACATGAAGCCAGCTCATCAATGGATGAATGGATCGA
AAGTTCGACCCCAGACGGATGAATAATAACTCCATTTGCATCTGTGATGTTTTTGAAGTACTGTATAACTGAATCAGCCTTTGGAACATCAGCTCTACGC
CACTTTTCGTACAGAACATAGAACTTCACAATGGCCACTGTAGGCTTGAAAGGGTCCTCCTTGATGTAAGGAAACTCAACGTCTCTTGGAGAAACATTAG
GTCCTAGCTTGAAGTGCCCAATAGCTTGAATAATACCAGCAGCACACCTCTCAGTTGCATGAATTATCTTAGGATTATCCTTCGCATTTTCTGCATGCCA
CTGGAGTAGTTCCTCTTGGGCATTGCTAACCATGACACCATGTACACCAGGGATACTGAATAATTCTGCATCATTACCA
page-top