Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig12677  (registered. 2003)
Contig Information
Length 1143 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Homology (BLAST) Top Hit unknown protein [Oryza sativa Japonica Group]
Score 276
Evalue 5.45135e-32
Total Hit Count 29
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig12677
GATTAGGGACGCACTTTTAGTTGGGTAAAAATATCATCAATTTGCTCCAGGGGCGCCAGAAATAAATCACATGCACAGGCATTTAACCATACATGGAGTA
GCTACCTTGGGATCAGGATAGATATTACACTTCTGTTTCTGAAACTGACCCCAAAAGACCACACCACGCACGCCAGCAATAAACACACTAGGCTGGTATC
TTGGATATGGGAATCAAACCTATGATTTCTGCAATCTTGAGCTTCTTCCTGGCATAATGCACATACCTCCTTGGCAGATCACACTTGAAACTAACTTCCT
GCGAAATTAACACACGCGCTAGCCACTCTGGAACTTCCTTATTGACGCCCGCTGTGCACCGTCGAAATTTTTTCTCCAATCCCAACGAGACAGGTTGACT
CAGCTCGTGCTCCAAATCACGTTTGCGTAATGGAAACAGGTTCTCCTCATACACATGCTTCATAGCATCTCTCAAAGACATCTGATCAGACCCATTGACC
AGCTTCCAAATCTCAAAAAACACAGAGTCAAGATCTTTCACGGACTCGAGATAATTGCTCGTTGTATACTCCTGGAAACCATAATATGCTAGCCCCAGAG
GAATGTTTTCGAACCTAGTAGCAATCCTAACTGCTTGGCGCCAAGCTTTTGCACGCAATTCATGCCACTCCATATAGCCTTTAAGCGCATGTTCTTCAAT
CCACTTAAGATCCTTCACAATCGTTTCCCAGTAGAGCAGATAATCTCTATCAGTTTCAGGGGTGCTATAAAAACTCTCGGTATTCATTCCAACTTTCATA
CTCAACGCCCCCTTCATTACAAGGGACTAGCCGCTGATAGTCGCTCAAGGTCGCGGGTGAAGAGGTGCCCAAGTCAAACCACCAGCCCAAGGCTTCATCT
TCATGGTAAAGACGGTGGTTGTCCAAGGGAAGGTCTGGAGGGTACTGGGAGTCGAATGCAGCATCGTCAATAGGCACTCCTTTGAGCAACATGCAAGCTT
TGAGGCGGTATCGTGCGTACTTGTGACAGAGCCTGTTCGCCTCCTCTTCATCCAATCTATCCTCGGTGTCAACTTCATGTACTATGTGAGACATGAGCCG
TGCATCGTCTGCCTNGAATTCCTCCTCGGGGATATCATCCATC
page-top