Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig12652  (registered. 2003)
Contig Information
Length 797 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_SHDr Shoot grown with dessication 1
Homology (BLAST) Top Hit unnamed protein product [Oryza sativa Japonica Group] >gi|218188387|gb|EEC70814.1| hypothetical protein OsI_02278 [Oryza sativa Indica Group]
Score 130
Evalue 8.34217e-06
Total Hit Count 6
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig12652
GTGGACTAAGGACGTGTCACCCTACACATACTCCTATATAACATGACGCAACAAACTAAAGAAAAATAATAAGAAAAAGCTAAGCCAAAATATCTATGCT
AGCTTGGAGTAGTGCTACTGTCTCTGCATGCTGAGCTCCCTGCGGAAGTTGCCGATGAACCTCTCCGTGTTGGCAAACAGCTCCTCCCGACTCATCTTCA
CGTCCCCGTCCATGTCGACTTCACAATCTTCCTCCTCCTCCTCCTCCTCCTCCTGGCGTGCCTTTTCCTCTTCGCCGGCTTGCTGGCCGCCGTTCAGCGA
GCTGAGGAAGAAGATGCTCGCCGTCGACGGGCACTTTTTCAGCACCTTCAGCACCACCTCCTTGGTCTTGGTCTTCAGCTCGAATATATTACTCGCCACA
AAGGCAGGCACCACGACAAGATCACCCAGAACCGCCGCCCGTTCGTCGGGACGGACTGATTCAGCTCCAGCCCTCTGGAACGGCGAGGCCTCGACGGCCT
GACCGGCACTCGGAGACCCGTGCCGGTCTTCGTCGTCGGCGATGGAAGCGCCGCCGCCGCCAACGAAGGCCTGGATGCCGAGCGCGAGGACGATGCCGTT
GAAGAGGAGGTAGCCGTAGGCGACCCTGAGGAAGACGGGCAGCAGCAGCGCGAGGAGGAGGAGGGCGAGGAGGGAGCTCAGCTTGGCCACCTGGGAGATC
AGTGCCGCCGGCGGGAGCGTGAGCTTGACCCCCATTGATCACGAGCTCTGCCGACTTGCCGATGTAGCTAGCTAGGTAGGCTAGTGGTTCAGGTGCA
page-top