Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6606  (registered. 2012)
Contig Information
Length 1066 bp
Clones alternative view 18 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VHS Shoot with heat shock treatment 3
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_SP 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|134102|sp|P08823.1|RUBA_WHEAT|RUBA_WHEAT RecName: Full=RuBisCO large subunit-binding protein subunit alpha,"
Score 512
Evalue 3.00E-143
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6606
TTTTTTTTTTTTTTTTGGTGTTATCAGTATTTATTTATTTCAAAAATGAAGCGGAATATTTCTCTGATTCACAAGAGTTCAGATCAGGCGAGGAAGGTTT
ACCGTTCGAGTCGCAAAAATGGCAATCCTACTCTTACTCTAGACCTTTCACTTCCAGTTGATCTCAACCAAAATTCTACTGCTTGGCCTGTCTGAACTGA
AGCATCTAAAAACACGGAGGAGGCCTGAAGAGATCTTTACATACAGCTCAATCAGACGGAGAGCTGCCCCTCCGCTGGCTCGGCGACCTTAGGCTTCGGC
TTGGGCTTCTCGACGACGATCGCTTGCGTGGTGAGGACCATTCCGGACACCGAGGCAGCGTTCTGGAGCGCGCATCTCGTCACCTTGGCGGGGTCGATGA
CGCCCGACTCGATCAGGTTCTCGTACTTGTCGGTCATCGCGTTGTAACCCATCTCCCACTCGCTCTCCCTGATCTTCTCGATCACGACCTCCCCTTCCAC
TCCGGCGTTGTTGGCGATCAGTGACGCCGGTGCTTGCAATGCCTTTTGAATGATGTCAGCACCAAGGCGCTCATCATGGTCTTCGATGGTTTCTTTGATC
GCGGGGACGTAAGTAGACAGGTGCACATACGCCGCACCACCACCGGGAACAATGCCCTCCTCGATGGCTGCGAAAGTGGCATTCTTCGCGTCCTCAATCC
GCAGCTGACGGTCCTCGAGCTCTGTCTCGGTTGTTGCTCCAACCTTGATGACGGCCACACCACCAGAAAGCTTGGCAATCCTCTCAGCCAATTTCTCAGA
GTCATAGATGGAATCAGTTTCAGAAAGCTCCTTCTTTAGCTGTGCAACCCTCGCCTGGATCTCGTCTTTGCTAGCCGCATCTGCTATGAGGGTAGTTGTA
GTCTGATGGATTGTGATTTTCCTTGCTGTCCCAAGTTGATCTACTGTTGCATTCTCAACCAACAGACCAAGATCCTTCGCTAGGTACTCAGCGCCTGTCA
CGATGGCAATATCCTGAAGGACAGCCTTCCGCCGCTCACCAAAACTTGGGGCTTTGATCGCCGCAA
page-top