Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6605  (registered. 2012)
Contig Information
Length 1340 bp
Clones alternative view 55 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_f Spike at flowering date 4
Wh_h Spike at heading date 5
Wh_oh Pistil at heading date 3
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 4
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 6
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 6
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_SP 2
WH_XA Root 2
WH_XB Root 1
WH_XD Root, treated at 50 microM Al for 6h 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|194707582|gb|ACF87875.1|| unknown [Zea mays]
Score 499
Evalue 2.00E-139
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6605
TCTCTGTCCCATACGCCTCGCCTCTTGAGCGCGCTCTTGAAGGAAGGCTCGACACCTCTGCCTTCTGCTCTCCTCGGCTCTGCATCCGTGAGAGCTGTTG
CATTGCTGCAGCTCGCGAGCGCCCGGGTCGTTAGTAGTTCTTTCACCACAGCCCGGATCATGGAGTTCGACGAGCGCTGCCTCAAGGTCCAGGACCCCAA
ATTTGATTGCCTCCTCTTTGACCTGGACGACACTCTGTACCCGCTGAGCTCGGGGATCTCATCACACGTCAAGACTAACATTGAAGCTTACATGGTTGAG
AAGCTGGGTATTGAGGAGAGCAAGATCGAAAACCTTGGCAACCTGCTGTACAAGAACTATGGCACCACGATGGCGGGCCTCAGGGCAATTGGCTACAACT
TCGACTACGATGAGTACCACAGCTTTGTCCATGGAAGACTGCCCTACGACAACATCAAGCCCGACCCCGTTCTCAAGCAGATTCTCAAGAACATGCGCAT
GCGCAAGCTCATTTTCACCAACGGTGACATGATCCATGCCGTGAGAGCCCTCAAGAGGCTGGGCCTGGAGGACTGCTTCGAGGGGATCATCTGCTTCGAG
ACCCTGAACCCGCCGTGCCTGCTGACGCCGTGCGACCAGGCGCCGGAGATCTTCGACATCGCCGGCCACTTCGCCGGGTTAGGCAGCGCCGACGACCTGC
CCAGGACCCCCGTCCTATGCAAGCCCAACGTCGGCGCCATGGAGGCGGCCCTCAGGATCGCCAACGTCAACCCTTACAAGGCGATTTTCTTCGACGACAG
CGTGCGCAACATTCAGGCTGGCAAGCGAATCGGCCTCCACACAGTGCTGGTTGGCACGTCACAGCGGGTGAAGGGCGCGGATCACGCGCTGGAGAGCATC
CACAACATCCGGGAGGCGCTGCCGGAGCTGTGGGAGGAGGCCGAGAAGACGGAGGACGTGCTCTACTCGGACCGCGTGGCGATCGAGACCTCGGTGACCG
CGTAGACGCCGCTGGCTCTCGGTGCACCTTCAGTCTGATACCCCAAGCGCAACCCGATTCGACCCCAGCCTGCCGGACAGATGATCTTCACGTGGAATGC
TCTTCAGCATTGGCCGGGAAACCAGTACAGTATCCATCACGAGGAGAGGAGGGGGAGTTCAGAAAGTCAGGAATTAATGCAGCATGCGCACCATGCCGGG
CCGGTCCTAATATATGTATATGTATGTGTCGATCAGATCTTTGCTTGTAAATTACTACTACTAGTAAGGAGGAATAATAAAGAGAAAAACGGGGTTACTT
GTACGCGACTTATTCGTATTTAGCCGGAGCAATAAATCAA
page-top