Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig660  (registered. 2012)
Contig Information
Length 935 bp
Clones alternative view 61 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 6
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 1
Wh_r Root 1
Wh_yd Spikelet at late flowering 1
Wh_CSEC Callus 8
Wh_DPA20 Seed DPA20 4
Wh_EM Dormant seed with water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 2
Wh_VSCB Liquid cultured tissue 2
WH_XI Two-week old seedlings(22℃ 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_SP 6
WH_XA Root 3
WH_XB Root 5
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242068069|ref|XP_002449311.1|| hypothetical protein SORBIDRAFT_05g007540 [Sorghum bicolor]
Score 353
Evalue 2.00E-95
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig660
TTTTTTTTTTGCGTTTCATAACTCATTTCAGTCTACATTCGCTAACAACCAGCCCGAAAAGGGTGGGCGCACGGAATAATTTCAGGCATCAGACTTCTCA
TCTGCATATGAAAGCAGACCAAACCAAAAAAAAAGCAGCTGAGGGCTAGCAGTTGATGGATCTGCTGCGCATTACTAATACGAAACAAAGTCAAGAGTTG
CATCAAAGCAGCAGCATCCTTAGTGACTGAAAACATCAAAGTGCTTAACCAAAACTTCCACATGCAAAAATCTTCAAACTCTTACACGCTAAAACACACA
GACCAGTAGAGTAGAGTAGGGACCCGCTCACATGAACAGGTTGGGCCTCGTCGCCTTGTAGGTGGTCTTGAGCTTGCGGGTGGGTGGGCGAACCTTCTGG
TACACCAGCGGGAACTTGATCTTGGAGTTGTGGAACTGCTTCGTGTTGTCCCTCTTGCACAGCTTGAAGTCCACCGTCGCAGTCTTGATGATCTGGATGC
AGGGGGCACGCACGCGGTGCCGTGACGCCATCTCCGTGTACATCTGCTCCACGCCGCCGTTCAGGGTCGTGTCGCGGTACTCCTTGTACATGTTGTGGTA
ACCGGTCCTGCTCTGGTAGCGCAGCCAGATGCCGTAGTTCTTGATGGTGGTGGGGTTCTTCTCAAAGATCTCGTTGATGGCGAGCATCTGGCCGTTGGCC
TTCTTCACCTTCTTGAGCTTCCTCAGGAAGTACCAGAACTTGGACTTGGCGCGGACCTCGTTGGTGGCCCAGAGCTTCATGCGGTAGATCTTGGGCTGCT
CATCGCCGGGGGTCGGCAGCGCGCGACCCACCACCTGGTACTGGTGGAACCTGTGGGCGACCATTCTGGCGAGCTCTCGAGACCGGAGGCGGAGGAGAAC
TGAAACCTAAGGAGGGGAGAGGGAGCGTTTTTTCC
page-top