Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6590  (registered. 2012)
Contig Information
Length 1707 bp
Clones alternative view 34 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_r Root 1
Wh_SH - 1
Wh_DPA20 Seed DPA20 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_V4816 Shoot grown under cold condition for 16days 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 3
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_SP 1
WH_XA Root 2
WH_XB Root 6
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|90289618|gb|ABD92942.1|| alpha tubulin-1D [Triticum aestivum]
Score 915
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6590
ATTTTGGCAAGACAAGGGAGAGAGAAGCAGAGGAGGCCGTTCTTTACGCCTTCCTGGGAAAAGAGCCGGGAGGAGGAGGAGGAGAAGGCGAGCAAGACGG
AGGAAAGCGAGACGAGATGAGGGAGATCATCAGCATCCACATCGGCCAGGCCGGGATCCAGGTCGGCAACGCCTGCTGGGAGCTCTACTGCCTCGAGCAC
GGCATCCAGCAGGATGGCACCATGCCCAGTGATACCACGGTCGGGGTTGCACACGATGCGTTCAACACGTTCTTCAGTGAGACCGGTGCGGGCAAGCATG
TGCCGAGGGCCATCTTTGTCGACCTTGAGCCCACTGTCATCGATGAGGTGCGCACCGGTGCGTACCGCCAGCTCTTCCACCCGGAGCAGCTCATCTCTGG
CAAGGAGGATGCCGCTAACAACTTCGCCCGTGGCCACTACACTGTTGGAAAGGAGATTGTAGATCTATGTCTGGATCGTGTACGCAAATTGGCAGACAAT
TGCACCGGGCTGCAGGGATTCTTGGTGTTCAATGCTGTCGGTGGTGGAACTGGATCAGGACTGGGCTCTCTGTTGTTGGAGCGCCTCTCGGTTGATTATG
GCAAGAAATCTAAGCTTGGTTTCACCATTTACCCTTCCCCGCAGGTCTCGACAGCTGTTGTGGAACCATACAACAGTGTCCTCTCCACTCACTCTTTGCT
TGAGCACACCGACGTTGCGGTCCTCCTAGATAACGAGGCTATCTATGACATATGCCGGAGGTCTCTTGACATCGAGAGGCCAACCTACACCAACTTGAAC
AGGCTGATATCACAGATCATATCCTCACTTACCACCTCGCTGAGGTTCGATGGTGCCATCAATGTGGATGTCACAGAGTTCCAGACCAACCTCGTCCCTT
ACCCACGTATCCATTTCATGCTTTCGTCGTATGCCCCTGTTATCTCTGCCGAGAAGGCTTACCATGAGCAGCTCTCTGTGCCTGAAATCACCAATGCTGT
CTTTGAGCCCTCAAGCATGATGGCCAAGTGTGACCCTAGGCATGGCAAATATATGGCCTGCTGCTTGATGTACCGTGGTGATGTTGTTCCCAAGGACGTC
AATGCCGCAGTCGCAACCATCAAAACCAAGAGAACTGTCCAGTTCGTCGACTGGTGCCCTACCGGGTTCAAGTGTGGCATCAACTACCAGCCACCCTCCG
TTGTCCCCGGCGGCGACCTGGCAAAGGTTCAGCGGGCCGTGTGCATGATCAGCAACAACACTGCCGTTGCCGAAGTGTTCTCGCGCATCGACCACAAGTT
CGACTTGATGTACGCCAAGCGCGCGTTCGTGCACTGGTACGTCGGCGAGGGCATGGAGGAAGGTGAGTTCTCGGAGGCCCGTGAGGACTTGGCCGCTCTC
GAGAAGGACTACGAGGAGGTTGGCGCCGAAGGCGCAGACGATGAGGGCGACGAGGGGGATGACTACTAAGTAGCTGGTTAATAAGTAGTTGGCTGGTTAA
TGATTGGCTTTGATCTGTATACTCAGTAAGTATGGTTCCATTGCGTTACATATTGATTGCTGTTATGCGTGTTTCCTTTTCTTGTAATGTACTGAAGTTG
TTGTTAGGGTGGCCATGATTGTTGATACCCCATTTCCTCATTTTGGCTTTCGATGCTACTCGTCCCATGTTTGGTGTGTGTGCATCATTCTGAGCCGAAC
TGCAAAT
page-top