Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig12455  (registered. 2003)
Contig Information
Length 616 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Homology (BLAST) Top Hit Os01g0783500 [Oryza sativa (japonica cultivar-group)] >gi|53791695|dbj|BAD53290.1| universal stress protein-like [Oryza sativa Japonica Group] >gi|113533985|dbj|BAF06368.1| Os01g0783500 [Oryza sativa (japonica cultivar-group)] >gi|215701481|dbj|BAG92905.1| unnamed protein product [Oryza sativa Japonica Group]
Score 428
Evalue 1.34667e-40
Total Hit Count 89
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig12455
TCATAAAAATACAGCTCATGCACACAGTAAATAGTTCAATCTACTTGCAGTCGACAACATAAAACATCACACGACACAAACCAACAAAGACCCCCGCCAC
TTGAGAGCCCGGCCCTAAAGCCTGCCGGCAAAGCAAGTCCATGATATGCGCACGGTCATGCGGTGGATGCTGGATACAGAGTTGCTTCACTCAGATACGC
AGGGACCGCCTAGGTACACAAGCCTCATGGTTTCCTTGCGCTCCGGTTGGATGCCATTGCCTCAGTTCTCTTTGTGTGCGTCAGGCGCATCATGATACAC
GGGCTCATCCTCAGGCACGGTGTGCAGCTCATCTGTTGCTGCTGCTGCCTCCCCGGGGATACCTGCAGCGTCATCTGGGTAGCGAACAACCACAACCGGG
CAGACACAGTGATGCACACAGTAATCACTAACACTCCCGAGCCTCCCCTTGCCGCCCTTGCGCGAGGCCCCGAATCCGCGGCTTCCCATGATCATGGCGG
ACAGGCCAAGGCGCTCGGCCTCGAGGCAGAGGCGCTCCTTCATGTCGTGGTCCTTGACGACGTGGATCTTAAAGGGGATCTGCGCGGCGACGAGCGGCTG
CGCCAGGTCCTGCGAC
page-top