Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig12447  (registered. 2003)
Contig Information
Length 1003 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
Wh_EMI Dormant seed with water absorption after breaking 2
Homology (BLAST) Top Hit Os03g0157500 [Oryza sativa (japonica cultivar-group)] >gi|21397267|gb|AAM51831.1|AC105730_5 Putative FH protein interacting protein FIP2 [Oryza sativa (japonica cultivar-group)] >gi|108706270|gb|ABF94065.1| K+ channel tetramerisation domain containing protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113547486|dbj|BAF10929.1| Os03g0157500 [Oryza sativa (japonica cultivar-group)]
Score 1082
Evalue 5.00483e-116
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig12447
ATTTTGTAAGTGTACATGATGTCAGCCTCTCTTCTTGTACTATCTGATAGCTCCAAGAAGATTTGCTCCTCCAAGCTTAGCACCGGTTAAATCAGTTTCA
CGCAAATCAACTTCTCTCAAGTAGGCTCGCTGAAGATTTGCCCCTTGCAAGTTTGCACCCGACAACTTAGCCCCCTTGAGATTGGCCCCTTCAAGGTTAG
CTCCATTCAAATCAGCACCCGTAAGATTAGCATTCTGTAAATGGGCTGAACGGACATCTGTCTCAATGAAGCTACATCCCATTAAGCATGCATCTTGCAG
GTTTGCGCTTTGAACGTTTGCTCTGTCCAGGACAGCTTCTTGAAGATTTGCTCCAGTAAGCTCACACTCATGTAAATTTGCCTGTTCAAATGTAGAATGT
GCAGCTTCCACCAGCCTAAACTTTGCTTTATGAAGATTAGCACACGAAAAGTTGGTTCTCTCGATGCACGCATAGCTGAAGTCCACCTCTGATAAGTCAA
GCTTAGATAGATCAAGGCCAGATAGATTCAGTCCACGAAATCTGATTTTCTGGGCTTGAATGCACTTGATCACATCTTTGCGTGTCAATTCGGCCTCGCA
CGAATTGTCAGTCTTTTTCAAAGCCAATTTCTCATTTATGTAATCAGCCAAACCGAGCAACTGGTAGTACTCCGCTTCTCGCAGGAGTTGGTGGTACTCG
GACTCTGAGAGCGTGGGGATGGCACCGTCCCTTAGCCAATTGAGGATGTGCCTGAAATGCTTCCCATCCCTGTCCACGAACACCGCCCCCGTGGTGGGGT
GCTGCGGGAGCGTGTGCCTGCCGCTGAACATGGCGGCGAGCATGGAGTCGGGCTCCCGCTGCGTGAGCGTCTCGGCGGTGGTCGCGTACTTCGTCCCCCC
GATGTTGAGGAGGACCGGCGCGGCGGAGGAGGAGGACTCCGGCGACTGCATCGCCGCCGCGGCTCGGCGGTTCAGGGTGGAGAGCGGCCGGGGGTTTTGT
CCG
page-top