Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig12441  (registered. 2003)
Contig Information
Length 835 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VHS Shoot with heat shock treatment 1
Homology (BLAST) Top Hit hypothetical protein OsI_11301 [Oryza sativa Indica Group]
Score 713
Evalue 2.2596e-73
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig12441
GGGATACACGACCACACACGGCAAACAATGGAGGCGTCGCTGACCGCGGCCGCCGCCGCTACCTCGTCGTTTCCGCCGCAAATCCGTCGCCGAATCATCA
AATTCAACCCGCTCGTGCTCCCTAGGCGACCCCAATTCGGGGACTCCAAGATCCGGACCGCCAACTTCCGGGGACACCTGGCTGCGGCCTCGGCATCCAC
GCCGCCGCCGCCGGGAGGCGGCCTGTACTCGGCGGCGACGTACGAACTGACGCCGGATAACGTCGACCGCGTCCTCGACGACGTGCGCCCCTACCTCATC
TCCGACGGCGGCGACGTCGCCGTCGTGTCCGTAGAGGACGGCGTCGTCTCCCTTAGGCTTGAAGGGGCGTGCAGCAGTTGTCCCAGCTCGACGACGACGA
TGAACATGGGCATCGAGCGAGTGCTCAAGGAGAAGTTCGGTGACGCCATCAAGGACATCCGCCAGGTGTTCGACGGGGACCAGCAGCCGGAGGAGACGAC
GCCTGAGGCGGTGAACCGGCACCTGGACATACTGCGGCCGGCGATCGCGAACTACGGCGGGAGTGTTGAGGTGCTTGCCGTTGACGGCGAGGACTGCCTG
GTTAAGTATGACGGCCCAGAGTCCATCGGGAGTGGAGTGAAGGCAGCCATCAAGGAGAAGTTCCCCGACATCACGAACGTGGTGTTCACCCAGTGATCTA
CAGGTAGCCTGGCCGGCTTGATGCCATCCCAGTGCAGTAAGTGGCGACATGTACGAAATGCAGCGAGATTCTGTATCGTCTAGACAAGAGTTTCGATGTT
TCGTTTGGGTAGAAAAAGTTGCAGCACACACAAAC
page-top