Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig12361  (registered. 2003)
Contig Information
Length 798 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
Wh_EM Dormant seed with water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 1
Homology (BLAST) Top Hit hypothetical protein OsI_31489 [Oryza sativa Indica Group]
Score 753
Evalue 4.78962e-78
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig12361
TTATTTATTGGTAGTACAACACAGGGCTTAATTTACAGGGTAGTGAAAGTTTATTTATTGGCAGTACAACACAGGTTTAATTTACAAGGTAGTGAAGATC
ACACCTTCGGAGCTCTGACCGGCCTGTGGCTTGTGTAGGTGAAAGTGCGCATCAGCTTCGGTTGCGGAACTCGTTCATGAAGGACTCGTGGAACTCCTTG
AGGCGCGGGATCATCGCCTTGATCTTGTCCTCGCCGGGGAGGATCGTGCACCGGATATGCCATGTCCCGGTGGCCTTGTTGCGCCCAGACACCTGGTGGA
ATCCAGAGCCAGGGACAACGGCGATCCCGGTGGCGTTGAGAAGGCGGCACGCGTAGAACATGTCTGGAGACATGCCCTCGGCCTTGGCGGCTTTGATCGC
CGCTGCAGGGAGGTGGATCCGTGGGAAGGCGTAGATTGCACCTTCTACTTTGTTGCAGGTCATTCCCTCCAGGCTGCTGAATGCGCTCGCCAAGGTCTTG
GCGCGCTTGGCGAGAGATAAACGGATGTCTTCCTTTTCAGCCATAAAATCCTCAAAACAACCATCTCCCAGCTTCGGTGGATCCATAGCAAGGCTAGTAA
GAATTTGACCACTTGTGTTGGGGCAAAGAGTCACAGAAGCCACTTTGCGAATCTCACCCATCACATCATCTCCAAAACCACATATCTCCATGTAGCCTCC
CCTTCTGCCACATTCTCCANAGAACCCCATCGAGACCGAGTGAAATGACACTATGGAGATGTCATTCTCGTCATACCCAAGTGATCTGGCTACTTTCT
page-top