Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig12352  (registered. 2003)
Contig Information
Length 862 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_OKCS Seed DPA5 1
Wh_RDr Root of dessiccated seed 1
Homology (BLAST) Top Hit hypothetical protein OsI_00169 [Oryza sativa Indica Group]
Score 1154
Evalue 1.7511e-124
Total Hit Count 158
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig12352
GTTTTTCATAATTGATTTCCTCGCAAGGAGTCTTCTATGTTCTTTCTCCACCACTCCAGCAAGACTGGTCAAGTTTTCACTAGGTTTGGATGGCTTTTGC
ACAGGTGGATGAATAAGACTCAATGCTTTGTTCAGGGAATCAGCGAGGACACTAAGGTGGCTACTAAGCACATCAGATTCTATGTCCATGTTGCCAAAAT
GAACAGCTCCTGCCAAATGGTTAACTTTCATAGCAACAAAATTGTGCTTGACAGCATCAACAGCGATCTTCTCCACGACATTGAACTCAAAGAATGGGAT
CATTCTAGATAGCATATCAATTTTCATGGACTGGAAAATACGAGATGCCTGCTGCAGCACCCTCAGTGCAGTAAGCTTCTCCAATGCAGATTGGTACTGT
GATAAACGGATTTCCGGAACTGACGATGCAGCGGAAAGCTTTCCTCCAATCGTAGAAATCTTGGATAGCAGAGGCTGCACTTTTGATGCTAGATCCAGAG
GAAGGAACTCATGCTCCATAAGGTTGTATAAATCTTTTACTTCTTGGGAAGCACATGAAATCACACCTTTGGCAGCCAACTCAGAAAGAAGAGTTGCTCT
TGAAACCATTTCTCTATTCTCACGCTTGGAGTCGAGGGAGAAATTGACAAGGTTGGCCATACGCAAGCTACGGTCCTTCTCATTTTCAAGCTCAAGATGA
GATGCACCATATTTATGGTCATATGGTGTAACAGAAAGTGCAGCAAGCAAAACAGAAGATGCTAGTAATTGCAGATCCTTCTGAGTTAAATTCTTGTTGT
AGCTCTTCTGCAAGTTGAAAAGCTTCAGCCATGCATATGCATGATACAGGTGACTCTCAGAT
page-top