Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig12331  (registered. 2003)
Contig Information
Length 861 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 3
Homology (BLAST) Top Hit transposase [Secale sylvestre]
Score 98
Evalue 0.0490546
Total Hit Count 36
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig12331
AATAGTTGGCTTCAATCGCCACTTCACTCAAATACAAGTTAAACATACATCATCCAGAATACAATCAAAGGTCCGACTATGGAACCAAAATAAAAGAAGA
CAACCCCAAATGCTAGATTCCCGATCATCCCAACTGGACTCCACTACTGATCAACTGGAAACGAAACAACACAACGAACACGATCTTCATCGAGCTCCCA
CTTGAGCTCAGTTGTGTCATTTGCACTGGTATCATCGGCACCTGAGATCCCGCAAGGAAGTAGAACGAGTCCATGAACAAGACAAACGGACGTAGTCGAA
CGGATCCTCACAAATGCGACGTTATCAGAAATCGGGCCTAGCAGGCCGAAACTGAAGCTGGGCCAGAGAGGAGGCGCACTGGGCCAAAGAGGAATCATCG
TGGGCCGACCGGATCTGACCAATGCGGTCAACGTGGTTGCTGAGCGTTCATCGTCTCGTTCCTGAAGCAGGGACTCAGCGATGCAGGGGAGCTGGCGCGG
TCAACGCAGAGGAAACAGAAGCCTTGGCGCGGCCGCGACGCAGAGGACGCAGAGGCGGCCTAGCATTGCTTTGGACTCCGGCGAAAAACGGCGCGACGGG
GAGGTGGAAGGCGCTGGTGACCCATGGCAGCAATGAAGCAGAGGATACGAGCGGACACCGGGGTGCTCCGACGAGGTACTTGGTAGGGCAGCAGGGTCTA
GACAATGGGAACGAGGCCTAGACGACGGGAACAACGCAGAGAAGGTCGCTGGCGGCGGGGCTCCTCCTGTTAACGAACGAAGACAGAGGGAATGATGTGA
GAGCGAGCGAGAGAGAGAGAGAGAGGAAAACATGGGGAAGGAGGACAAGAAGGGCGACGGA
page-top