Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6570  (registered. 2012)
Contig Information
Length 1306 bp
Clones alternative view 9 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 4
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VWD Shoot grown with dessication 1
WH_XV Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115451013|ref|NP_001049107.1|| Os03g0170300 [Oryza sativa (japonica cultivar-group)]
Score 650
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6570
AAATTCGATGGCTGTCTCCTGCTCTTCTTCCTCCGTCTCGGGCTCCGCCAAAGCCCTAGCTTGCCTCCATACCTCCCACCTCGCGCCCCAAAGAACAGCA
TCAGCCCGCTTGCGCCTACAGTGTATCAAGATGTGCTCTGCTCCGGCTGCGCCAGGGGGGTCAAAGAAGACCGTCTGGGTATGGACAGAGAACCGGCAGG
TGATGACGGCAGCCGTAGAGAGGGGTTGGAACACTTTCCTCTTTGGATCCAAAGAGGTCGGCAAGGACTGGTCATCAACTGCTCGCATCCATCCTCTCTT
TATTGATGGCCTGGAGATTTTTGACGAGGGGAACCAAAAGGTTGCTGCAATTTCTGAAATCTCTTCCCCAAGTGAGCTGCAACTCATACAGCCAGACAAT
GTGGAAGTACAGAACAACGTGATTCACTTCCGAGGTGATTGGCAGGTTATACCAGCAGAAAATATAGTTGCTGCATTCCAAGGATGCGCTGGAGCTGTAT
TGGCTGTTTCGACAAACTCAACTGAGGCTCAAGTTTTTCTTGAGGCCTTGGAGCAAGGGCTTGATGGAGTTGTACTTAAAGTAGAGGACATGGATGATAT
TATTAAACTCAAGGATTATTTTGACAGAAGGAACGAGGCAAAGAGCCAGTTACAGTTGACAAAGGCTACTGTATCAAAGGTTGAAGTTGTTGGTATGGGC
GATCGTGTTTGTGTGGATCTCTGTAGTATCATGCGACCCGGTGAAGGCCTTCTGGTCGGTTCCTATGCAAGAGGAATGTTCCTTGTTCACTCTGAATGCT
TGGAGACAAACTACATTGCTAGCAGACCTTTCAGGGTCAATGCAGGGCCTGTGCATGCATATGTTACAGTCCCTGGCAACAAGACTAGCTACCTCTCAGA
GCTGCAATCAGGCAGGGAAGTAATTGTTGTTGATCAAAATGGGTTGTGGCGAACTTCAATTGTCGGCCGCGTGAAGATTGAATCAAGGCCTCTCATCCTT
GTAGAAGCAAAGGAGAACTCTGGAAATGGCACATATAGCATTTTCCTTCAAAATGCAGAGACAGTTGCACTTATTGGTCCTGACAGAGGATCTGGTGGAA
GGACTGCTATTCCTGTGACTTCACTGAAAGTTGGCGACGAAGTTCTGGTGAGGAAGCAGGGCGGCGCCCGTCACACTGGAATAGAGATTCAGGAGTTTAT
TGTCGAGAAATGAGACACACTGTGACATTTACCCGCCTTAGCAGGCTGGCATGCTCATCGCTGCTGTTTTTGTTCTCCACAACAAATTTGTGCAAGTTCA
TCAAAT
page-top