Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig12262  (registered. 2003)
Contig Information
Length 608 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 1
Homology (BLAST) Top Hit Os12g0530000 [Oryza sativa (japonica cultivar-group)] >gi|108936012|sp|Q2QPG9|H2AXB_ORYSJ RecName: Full=Probable histone H2AXb >gi|158513341|sp|A2ZL69|H2AXB_ORYSI RecName: Full=Probable histone H2AXb >gi|77555982|gb|ABA98778.1| Histone H2A, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113649427|dbj|BAF29939.1| Os12g0530000 [Oryza sativa (japonica cultivar-group)] >gi|125536865|gb|EAY83353.1| hypothetical protein OsI_38570 [Oryza sativa Indica Group] >gi|215768409|dbj|BAH00638.1| unnamed protein product [Oryza sativa Japonica Group]
Score 414
Evalue 5.5346e-39
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig12262
TTTTTTTTTTCGGACAGAACGCACATTAGCACTGACAAATCACAGGCAGTAACAACAAGAACAAGATTGCGAGCTGCAATCCATTCCAACCAGATCCACC
ACCAACATCGATGACACACCAACCCAAACATTCACAAGGACCATACTAATCTAATCTAAAACTCCTGGGAAGCGGAGCCGATGTCGCCCTTGCCCTTGCC
GGCCTTCTTGGGGAGCAGCGTGGTGTGGATGCTGGGCAGCACCCCGCCGGCGGCGATGGTGACCGAGCCCAGCAGACGGCTCAGCTCCTCGTCGTTGCGC
ACCGCCAGCTGGATGTGGCGCGGCACGATCCGGTTCTTCTTGTTGTCCCGCGCCGCGTTCCCGGCGAGCTCCAGGGTCTCGGCGGCGAGGTACTCGAGGA
CGGCGGCGAGGTATACGGGGGCGCCGGCGCCGACGCGCTGCGCGTACTTTCCGACCTTGAGGTACCGGGCGACGCGGCCGACGGGGAACTGCANGCCGGN
CTTGGACGACCGGGAGACGGACTTGGCGCTGGCGGCGGGCTTCNCCTTTCCCCTCCCGCTGCCGGCAATGGCCATCTTCTTGTTCGCGGTGGAGCGGGGG
GGTCCCGG
page-top