Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6550  (registered. 2012)
Contig Information
Length 2396 bp
Clones alternative view 42 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_V4816 Shoot grown under cold condition for 16days 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23Ž 6
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 8
WH_XF Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115483648|ref|NP_001065494.1|| Os10g0577800 [Oryza sativa (japonica cultivar-group)]
Score 847
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6550
ACCAAACTAGGAGGGTAAACAAGGATTCTTCTCCCTTGAAACCATCTTAGGTTCACAAGTATAACAGTTTCCTCTTTGCAACTACTAAAACAGACAGACA
GAGCGGCAGATTCATACAGACGCAAATAAACTCAGAAGACTACATTCCTTTCCAACTCATGATAACAAGTCGACCAGTTCCTTCCTCCAATCCACCATGG
TCACTGACCTCATGCCTTGGCTGGAGCATCTGCTGCTTCTCGCTTCACCATCGGAGGCAACTTATCTTGGAGCCGAATTATTGTGGATACCAGCATTCTG
TCACCAACTATGAGCCGCAGCCTCTTCACTAGGTCAATTCTGCTTATTTTCTTGGCCTTGAATTCTTCATAACAGTTATTGATCATGTCCATTTTCTCGC
GAGGAAGTTTGGTTGAAATAGCTGCAAATAACATGGAAAAAGGCATCCAAGGTGTACTTGGAGCTTTTGCCATTGATCCTCCTAACATGGGGGCTTCATA
CTGACCACCCAATGCTGGAGATGCCTCAAGATTCATGTCCTGTGATACACTGTCGGCCGAACTTGGACTCAAGACCAGTGAGGCATCAGATGAATCCTGA
CAATCTTCTTGTGTGAAGAGGGAATCTTTGGCTTTAGATGGCAATTTGATGGTGACTACAAATTCAGAATAGATGTGACTATTCAGATTCATATCCCATA
CGATGTAATGCTGCGGGTTTTTAAGGTCATCTACACCGCTATCAAAATACTCGTTACTAGGCTGGTGCTGCTTAGATCCATGGTGAACTATTTCTACGTT
CCCCATTACAACCCGGCACAGCATCATATAGATGATGCCATTTTCATCAACATCAGAGTAATTCACACAGTTAATGGAGCAGTTAGCTGGTGCAAGGAGT
ACGCCAGTTCCATAGGGTGGACACCTAGTGGGCTTTTTAATTTGCAAGGTGCCATTCAGCATCATTTCATCCACAGCAGCTTTCGAGCAAGGAAGCCAAG
CATAACGCACATTTGCATTACCATGCTGAGATTTAGTAATCTCTGCCTGCTTTTGGAAGAGATTATAGCGGTCTTCTCTATAATTATTCAAGAATGGCGT
TCGGTGGATTCCAATAATATCCTTGGAACCAATAGCAGTACCCATTCCCTGCAGCAACATCTTCTGCACAACAGAGGTAGTTCCTTGAGCACGTGATTGC
CCGCCCAGCTTATCTTGCTGTGGTTGACAACTAAAGACTGCAGGCAGCGAAGTGTGTGGTTCATTCTCTCCCACAGTTTCTCTATGATCACAATTTATTT
TCCTGATGATACCCTTCTCGGCTCTAACTCTCTTATCACTGGAAACCTCTTCAGTACTGGACTCAAAGTTTGAGCTTTCTGCGGAACTCTCTGATGCTCC
ATACTGGTCATTTATTTCACGTGCCCCATTAGGCTCAGCTCTAACATAGACATGATCTCCATTGCCGAGATCTTTCCTCCTATATACTATCTGATCTTCA
ATAAGAACTTCTGGGAAGTAACGCCTTCCATTGTCATCAATCCAGGCGATTGGCCTCTGAAGACCTGACTTTGAGTCAATGAATGTCATGTGGACAAAGT
CCAGCAAAAATAGCTGGTTCTGGTATCCTACTTCTGTGATGGTCTTCTTTGTCCGGAAATCAACTTGAGCCAGCTTGACAATTTTTTCTGGAAATTCTTT
CCAGTTGCCACTTTGGCGGAGCAGAATACGCTTAGGTGATGCACTGGTCATGTAGTTCTGATAGCTCTGTAAAATCTGCCTGTTAAAGTGGCACGCGATG
TTCGCCTTGCGATCTTCACCAACATACAGCCTGATATCAGAGTTTCCAGTAGGATGCTGATGCGATTGAGAGGTGTGGCAGGCATCAGCATGATATGCAG
CGGGGCTGTCCCGCTTCCTCTTGAGGCTAACTATATTCTGTCCACATTTAGCCAACACCTTTTCGTTCATCGCAGCCATTGTAGCAAGCAGAAATGAACA
CCAAGCAGAGACTAATTCCTTCTAGCAAACTGAACCCCAACAAGTCTAATATTTACACTAAGCTAATGGAGGAACCTCTGAGCATAGACTACTTCAATAT
CGACGAGCAGAAAAAGAATATCGGTCGGGTGAGATAAGGGCAAAAGAGTAGGAAACCTAGGGTTAGCGGCAGCATCAGCAGGGGTCACGGCGGAGGATAT
TGAGCGGTTCATCTTGCCCGATCTAACCCCCTGTCACCCCCCCTAGGACTCCCCTACGGAGCCCACTTTATCCCCCGGCTACGATTGCCGGAGCTACCCC
GCCGAAGATGCTCCCCTCGGCCGGCGGCGAGACGTGGCTGGTCAAAGCAAGGACTCGGCTCGGAGAATCGCTGCGGCGGCGGCAGAGGGGCGGGGG
page-top