Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig12035  (registered. 2003)
Contig Information
Length 510 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_PCDAM Anther at meiosis 2
Homology (BLAST) Top Hit Os04g0679100 [Oryza sativa (japonica cultivar-group)] >gi|32487391|emb|CAE05725.1| OSJNBb0017I01.5 [Oryza sativa (japonica cultivar-group)] >gi|90398981|emb|CAJ86253.1| H0801D08.11 [Oryza sativa (indica cultivar-group)] >gi|113565849|dbj|BAF16192.1| Os04g0679100 [Oryza sativa (japonica cultivar-group)] >gi|125550243|gb|EAY96065.1| hypothetical protein OsI_17938 [Oryza sativa Indica Group] >gi|125592078|gb|EAZ32428.1| hypothetical protein OsJ_015911 [Oryza sativa (japonica cultivar-group)] >gi|215736918|dbj|BAG95847.1| unnamed protein product [Oryza sativa Japonica Group]
Score 223
Evalue 4.6882e-17
Total Hit Count 40
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig12035
TTTTTTTTTTAACAGTGAAGAGTGCAGTTGTTTGCTGTGATACTAAGCTGAATGTTCAGGGCTGATCGATACATAGCCATCCTTGGTGTGGATCTCTACA
AAAAGATCGCTACAGGACAGGCGACACTCTGGGTATTGAAAACATAAGAAGTTTCAGTCTAAGCATAGTCATGGTTCTGGTGTTTCTGTAAAAAGAAAAG
AAGCTACTCTGATGCTGCAGGCTGCTCCTTCTCCGTCTCTGCGGCAGGGCCGTTGGCGGGTGCTTCTTTGCTCTCTGCGGGCTGCTTGGCTCCGTTTGCT
GGTGCTGGTGCGCCGTCTTCTGCACCTTCCTTGGCGCCTTCCTTGGCAGCAGGGGCTGGTGGAGGTTGCATCATGTGCGGCGGCGGAGCATGCTTGAGCT
TCACTAGGACCTGACGCATCCGGGAGAGGTCGGTGGGCTTGCCGGGCTTGGGACCCTGAATGACTGCGATGGATGGCTTCTTGTCCTTGTCTTTCTTGCC
CCGCTTCTCG
page-top