Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig12033  (registered. 2003)
Contig Information
Length 814 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_PCDAM Anther at meiosis 2
Homology (BLAST) Top Hit hypothetical protein OsI_14368 [Oryza sativa Indica Group]
Score 639
Evalue 8.19092e-65
Total Hit Count 86
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig12033
GCTCAATTTAGTGCAAATCAGAGGATTGTTCAAATATCTTCTACAAATTGTCCAGAATGCTACAACTCGATCATGTTCCAGAGGCAGTAAAACGGGCCTA
CCTGATCATCTAGCAAAGCACAGCAGCTCAAATTTAGTGCAAGTGAGAGGATTCTTCAGATAACTTCTAGGGACTACTGATCATCCAGTAAAGCACAACA
GGCAGTAGAATTACATTTCGCTCAAGATTAGAACGGCCGCGTAACAACACGTAACACAGCCTGCTAGTGCTTTGTTTAATCACGAGCCCTAGGAAAAGTT
AGTTAAAGGCAGTCTCATGGCTTCAGCTCAGGAGGCCGAAAGCGGGATCGGTCTCACCGCACCCTGTATGCGCCGGAATGCGGTCTTGATCCGTTCTTTC
AGCCCAGCGTTCTCGCACTCGACATCACCGCTCCTGCCATCCAAGTGCGCGACGTCTCCATCCACAGTTATAACAAGCTTCCCTTCCTCTGCAACTTTAA
CGTCGCCGAAGAGCGATACCATCAGAGAATACACCACCTTACGCGCCACCTTCTCTGTTTCTTCTTCCGTCTTCACCGCTTCTTCGATCGGAACAACCTT
CGGACCCTCACGGCCAATGTTCAAGATCATGGCCACCACCGAGTCAGACACCATGTCGCTTATGGGATCAGACGACCACTGCAGCGTCACGTACCTCTCT
GAATCCAGGCGGATGGCCACCCTCTCGTGAACAGTCAGTGTTGGAACATCTTCTTCAGCTGATGATTCCACGCTCTCGTATATTTGCTTCAGTCTGTACT
TGACCACCTCAAAG
page-top