Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig11880  (registered. 2003)
Contig Information
Length 820 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_RDr Root of dessiccated seed 1
Homology (BLAST) Top Hit DAG protein [Zea mays]
Score 482
Evalue 1.33282e-46
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig11880
TTTTTTTTTTCAAAAGCACAGACCACTCCAGACTCCACAAGCCTTTCCAAACGTCAAATATATGGCTACAAGAGATAGTAACGCACATCAATAATAAGTC
TGATGTGAATGCAGGCAACAAGACAAAATAAAGTAGTTCAGCTGTTTATTTTACAGGTGGAAATTTCTACATTTCAAGTAGAGGAACTAATGCCTTGTTC
TTAAGTGAAGCTACTTCTCATCAGGTCCTTACTGCCTACCCTGCCAGTTCCCTTGTTGTCCTTCACCTGGGCTAGGATACTGACCAGAAACCCCTTGCAA
GTTATCCCCTCCATATGCAGGCGCTGCACCCTGTCTGTTGTCTCCACCATAACCAGGACCCCCTTGGTTACCTCCAGGATATCTCGACCCAGACGGTTGT
CCATAAGCTGGAGGTCCAGATGGCTTCCCATAGGATCCAGGAGCAGGTGGTTGACCATAATTTCCAGGTGCAGGCGGTTGACCGTAATTTCCAGGTGCAG
GTGGTTGACCATAATTTCCAGGTGCAGGCGGTTGACCATAATTTCCAGGTGCTGAAGGGCCACCAGGCCTGAGATCTCCTTCCTGTCCTTGCGAGAAACT
CCTGCGCTCTTGTGGATCTTGGAAACCTTGACCGGCTTCATTTACACGCCCTTGGTACCCACCAGGCGCATTGTAACCTGGATGGTCGGCAGAATCATTC
CTCCCATAACCTCTACCATCTTGCCCAGCTTGTGCGTAATTCTGCTGTGGAGCGTAGCCTCTTACGTCTTGCTGTGGGCGGGACCCTTGGAAGTTTCCTT
GTGGTGGCGACCTGTTCCCT
page-top