Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig11779  (registered. 2003)
Contig Information
Length 863 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_VABA Shoot with ABA treatment 1
Homology (BLAST) Top Hit Putative Rhomboid family protein [Oryza sativa (japonica cultivar-group)]
Score 745
Evalue 4.67274e-77
Total Hit Count 20
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig11779
ATGTTTCATTACTGGGGCACCTCTCTGGCATCTTGTCTGGATTTGCATACACTTATGGGTTGTTCAACTACTTGCTGCCTGGACCATCATTTTACTCTTC
TATCGAAGGCTTGTCCATGCTATCTGTTTGTGTTAGGCGTCCTGGCTTTATTCTCTGTACTGGAGGAACAACATATGGCCAGCTTCCTACACATTCTAAC
ATGTCCACTCCACCCAGCGCTCTGATAAATGCAAATTTCTTGAGAAATATTTCGTCATGGATGCCAAGTAGGCGGACATCCACTGTTCAGACGTCTACTA
ATCAGGAACAAGAAGACCCGAGATTTCCAGGGAGAGGGCGGACGCTTGCTTCTACAGGAACTGAACCAACTGCAAGGGAGGCCAATGCAAATTTGCATGC
TAGGTTGTTGGATAACTCAACCCCAAGCGACCTTCTAACAAATTCACAGCATACAGCAGCAAACGCTGTCAGAGCTGATGCAACAGTAACAGCTGACCAG
ACTGATACATTCGATGAAGAGCTTAAGAAGCTGGTTGCGATGGGCTTTGAAAGGACTCAGGCTGAAGTTGCTCTTGCCGCCGCGGACGGAGATCCAAACG
TTGCCATTGAGATTCTCATGAGCCAGCAGGATTAGGGATTAGCCACACAATTCTATATCGAAGTGAGCGCAGTTATCGAGCATCATATCTCTTGCTTATC
TGGAGGTTAGGTTCAGACTGTGGATGGGTAGTGGACTTTATAGAGATCATGGTGACAGAGTGGTTTTCGGAGAAGGTGCCATTGATTATGCAATTTGTAT
AGGTGCAGAAGCTACTGTGTAGTGCCTGCTTGCATTTTGTCCAATCTTATGTAGTACACTAGT
page-top