Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6520  (registered. 2012)
Contig Information
Length 970 bp
Clones alternative view 43 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Wh_SH - 1
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 8
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VHS Shoot with heat shock treatment 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23Ž 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XB Root 1
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XE Seedling, infected with leaf rust 8
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 7
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|210061129|gb|ACJ05645.1|| ferritin 1A [Triticum aestivum]
Score 394
Evalue 1.00E-107
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6520
TGTTCCAGCCGTTCGAGGAGCTTAAGGGGGAGCTCTCGCTCGTGCCGCAGGGCAAGGACCAGTCGCTCGCCAGGCACAAGTTCGTCGACGAGTGCGAGGC
CGCCCTCAACGAGCAGATCAATGTGGAGTACAATGCCTCGTACGCGTATCACTCCCTCTTTGCATACTTCGACCGCGACAACGTTGCTCTCAAGGGATTT
GCCAAGTTCTTCAAGGAGTCAAGCGATGAGGAGAGAGGACACGCCGAGAAGCTCATGGAGTACCAGAACAAACGTGGAGGGAGGGTGAGGCTCCAGTCAA
TCGTCACACCCTTAACAGAGTTCGACCATCCTGAGAAAGGCGATGCCCTGTATGCAATGGAATTGGCTCTAGCTCTTGAAAAGCTGGTGAATGAGAAACT
GCACAACCTGCACAGTGTAGCTACAAGGTGCAATGATCCTCAGCTGACCGACTTTGTTGAGAGTGAATTCCTTCAGGAGCAGGTTGACGCCATCAAGAAG
ATCTCTGAGTATGTGTCGCAGCTGAGAAGAGTCGGCAAAGGCCACGGAGTGTGGCACTTCGATCAGATGCTGCTTGAGGAGGCAGCTTGAAGGACACGAC
GACTACGGGCAATGGAGGATGTAGGTGTGATATGTCAAGTAGTGGACAGATAAGCCAACCACTGGATGTGGTTTTCAGGGATTTTTGCAGTGGGATTTGT
AGGGTACTATGCTGCGCTGTGTTTGGGATTTGAAATAAAACGATGGGAGATGTGCCACGCTCTTAAATGCCAGTCTTCTGCTCTAATCTTGCTAAATTAC
TTGTTGCATTTTGCAGCTTGTCTACCTTTACAGTGACTACCTTCTTTTGGCTGTGCTCATTTGGCAAAACAGTTTGTCTAATTCACATCTACTTCGTGTC
TTTTTAGACATTTCAAATAGACAACAACATACGGATGTATGTAGACATATTTTATAGTGTAAAAAAAAAA
page-top