Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig11732  (registered. 2003)
Contig Information
Length 1114 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 3
Homology (BLAST) Top Hit polyprotein [Sorghum bicolor]
Score 288
Evalue 6.90375e-24
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig11732
CACAATAAAGAACAAGTATCCGCTCCCCAGGATCAACGACCTATATGATCAGCTCGCTGGATCCTCAGTCTTCTCTAAGATGGATTTGAGGTTGGGCTAC
CATTAAATCAAAATCAAGAATGGGGACATCTCTAAAACGGCCTTTGTTACTCGTCATGGCCAATACGAGTACACTGTCATGTCCTTCGGTTTAACCAATG
CCCCAACCACTTTCTCTCATGTTCACGTGTTACTAATCAGTAGTACCTTATATGATTGATGGATACAAGCCTAGTTCAGTTCTACTACCCCATTATGTTG
CTAAAATGGATTCAGAATCTTGATATGATGTTGTTAGTGTCTATGCAATCCTTTGCAAAGTGTCTCAAAATCTTGATATGATGTTGTTGAGTGTCTATTC
AATGATGACTATTATGCGGGCTAGAACTGGCTTGCTTTGGAACACTGACTTCCGCTATATGCCAGCGTCACTCCCTGGGGCAGAAGGTTATTTCACAGCT
ATTTACACCGACTCTCATCATGAGGACTCGCTACTTCGCACTACCGCACAGATGCTTGAGGATAAGGACCGTGAAAATCGTGCCTTGCGATTGGAGCTTT
TCAACTCCCGGTCTGATCACTGGGACACTTTGACCCGGTTTGCACCTGCTGTGCAGGCTGGGTATATGGATATGCGGGATCTGTACCCCGTGCGGTCTAG
TCTGCTGGATCATATGGATTGTCGTGATGTAGGGGGCATCACTCCTCCCCATGGACCTCTTCTGTCACCATTTGTTGGTCCCAGGCCACATCTGTGTCCC
TATGGACTGCAGGCTCCACAGGATCGACTGTTTCCAGATGATCACGTCCAGCTTCCAGGACATGGGGGTAATCTCTACGAAGATTACTACGGAGATGTTT
GAGCTGATGGTAGCACCACTAGTATTGTAACAGTTATATCGTCCACCGTCCTGCGTGATTGTGGGATATGACTGAGCTGATGGTACCACTTTTNGGAGGT
GTAGAAATATAATGTATAGGAGCTTGGGATGCCTCCGATAAGATGTAATCTTCCTTTCATCGCAGTTGTACTTCGTTTGGTCTTGTACTAAACCTTGTAT
GGTGTGTATGACGA
page-top