Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig11731  (registered. 2003)
Contig Information
Length 510 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 3
Homology (BLAST) Top Hit hypothetical protein Syncc9902_0443 [Synechococcus sp. CC9902] >gi|78168314|gb|ABB25411.1| conserved hypothetical protein [Synechococcus sp. CC9902]
Score 81
Evalue 1.40154
Total Hit Count 3
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig11731
CCCACAGCCCCTGGCTGCTATACATACTGGACCAATTTAGCGATTGCTAAGGCGCAACGTCCTCGCACGTTCGTAGTCGGATCGTCAAAGTCGACTTCCA
CCAAAGCGAAATCCACCATCTCATCGAAAGACGGGACACCTTTGCCTCTATCAAAAATCCTACGGAACCTACTCTATTTCCCCTATGTTGTGCATCCTCT
CTGTTCTTCAGAACCATATACTACTATCCACGTCGAATCTGAAAGACAGAAACCACAACAGTACAACACCGAAACCGTATGAGCCCTGCGAGTTAAGAAG
CTAACAAATCCTACAGAACCTACTCAATCTTTCCCCTGTGCTGTCCATCATCTCTGTTCTTCAAAACCACACCACTATCCACATCGATCTGAAAGACAGG
CCATCTGGCAAGAGCCTTATCAGTCCTCCTCCTCGTCGGGGCCCAGGAATGAGGCAAAGGACTTGTGAAGCGACTTGTGAAAACAATTGATGGATTTGTC
ACCCTGCAAG
page-top