Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig11723  (registered. 2003)
Contig Information
Length 1243 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
Wh_EMC Dormant seed with cold treatment after water absorption 2
Homology (BLAST) Top Hit hypothetical protein OsI_10231 [Oryza sativa Indica Group]
Score 143
Evalue 5.22933e-07
Total Hit Count 14
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig11723
ACTATCATTCAGATACGATGCACCGAAAGAGCAGGTGACTAACTACTGCCAGAACTATCGTTCAAGATACGATGCACCGAAAGAGCAGGTGACTATGGTA
ATATACTGTTTAGTTCAGCAGCAAGCTGCAGCCAACTTGCTCACCCCGAAACCTGGCTACAACATGTACATGATTCCGTAGGGTGGTTTCAGGACAGGAC
AATTATGAAAGGCAAAAGAGCAGGACGAAAGCAGCCTGAAAGCAGCCCTAAGCTAGTATCTACTGCAAGATCTTCCATGCCATCCAGCAAAGTGACAACA
TACCAACAGACATCAGCATGCAGCCGTCCAAGTACCACCAGCGGTTCAAAGCCACATTCCCCCCAAAGTTATTGCGCTTGAAAATATGTTGCTGCTGCTT
GTGAGTCCTTTTCTTAGCACGGTTTCGCTTCTTGCTGTGGCGAACCTTCTCAGCATTAGAGCCAAACGACTGGTGGCCCTTCTTCGTATAGCCTGACTTC
TCATATTGTTCAAATATTCCTACTCCTTGGTACCTTTCTTCAGGAGTCACTGATGGTAGCATACTTTGCAGAAGATTGTCTAAAATTGGAAGGGCCACAA
TGATTTTGCTCCTCAGGGTCTCATCACTTGCCTCCTCATTAAATGACTCGGTTAGCAGCATATCAAAACCCTCAAATGCACGTAAGAGATGTTGCATATT
ATTGGAGGCTTCATCAGTGCATGTAGCATATTTCAGTAGCGCATGAATATGTACACACAAAGAGGATACTGGGCAACACTCGGTAAGCAGTGCTTTGGAT
TCCTTGTAAGTTGGCAAGTCACAATCTAAGAATAGATCTGCAAAGCACCACATAGACGTGAATCTTCTAGTCATGACAGTCACAACTTTGTAAGAACGTA
TATGTGCAGCAGCAGGAAATAATGCTTCAAGGGCAGTACTTGCTTAACATTTCTATCGGACACAAATGAAGGGGGAAATCAAAAGATATTATACTTGACC
CGATCATAGTGATATTGCATATTAAACTAACACATTTGCATATTGCCACAAGGAAAAGGAAAATCATTTAAGATCAAGACCCTAAATATCCACTTGGTTG
AAGTTGGCAAACATTCACTTGCACATGTGATATATTAGAACAGAAGTCAGTATAAAAGGCTAAATATATCAAGAGCGGACTAATACCAAGTTCCCTAAAC
CATTCTCGAGTCTGCTGCACTTGCATAACAAACTGCGCCAAAC
page-top