Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6515  (registered. 2012)
Contig Information
Length 627 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 1
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 2
Wh_KMP Shoot grown under continuous light 3
Wh_V4816 Shoot grown under cold condition for 16days 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig6515
GCACGAGGCACGATGCGAGCAGCAGCAGCCCGACGAACTCCAGAGCTCGCAGCCGACGCAGGCCGCCGTCTGCGTGACGGGCCTCCGCCCGCACCTCCCA
CCGTAGCACGCCGCAATGGAGGCCAAGCGCCCATGGAATCGCCTGAGCTCTCCTCCCAGCCGCCGTTCTCCTTCAAATTCGTCGGGATCCGGTTGGATCT
AGACGCTGGCGCCCCGTTCCCGATCTTCCCGCCTTGCTTGGGTCGTCGGCCACCGCGACGATGTCAATATCGCTCGCGGGATCCAGCGCCACCGCTGCTG
GCCACTTCCTCGCCGGAGATGCCCCCACATCCGCGGCTCCCCACACGAGCAGCAGCAGCGAACACGTCGCTAAGGCCGTCTCCGGCGGTGTCTTTTTCTT
TTTATAGAAGTTTGCCAAATCTGTGCCAGAACAGCCATGGCGATGAACTCCAGCTCAAGGCCCGCGAGCGCTTGGTGGCGTTTGATGCGGTGCCTGGAGA
ATATCTCTGGGCAGAGTAGTAGGCCAGATCTAGTTTAGGAAAAAAAATCTGTAATTCCAAGTTTTTCTTGTGTATTTCTTCTTTTTGGTAAAACAAATTT
TAGTTAGCTGGTAAAAAAAAAAAAAAA
page-top