Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig11611  (registered. 2003)
Contig Information
Length 1093 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_VWD Shoot grown with dessication 3
Homology (BLAST) Top Hit Os10g0517400 [Oryza sativa (japonica cultivar-group)] >gi|13786444|gb|AAK39569.1|AC025296_4 putative aldo/keto reductase [Oryza sativa] >gi|31433073|gb|AAP54633.1| aldo/keto reductase family protein, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113639677|dbj|BAF26982.1| Os10g0517400 [Oryza sativa (japonica cultivar-group)] >gi|125575407|gb|EAZ16691.1| hypothetical protein OsJ_030900 [Oryza sativa (japonica cultivar-group)] >gi|215767894|dbj|BAH00123.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218184886|gb|EEC67313.1| hypothetical protein OsI_34328 [Oryza sativa Indica Group]
Score 1568
Evalue 2.50935e-172
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig11611
CGGTTTCCCCCATGGGTTTTGGAACATGGGCTTGGGGCAACCAGCTGCTCTGGGGCTACCAGGAAAGCATGGATAGTGAACTGCAGGAGTGTTTCAATTT
GGCTCTGAAGAATGGCATAAACCTTTTCGACACCGCCGACTCTTATGGAACTGGGAAGTTGAATGGCCAAAGCGAAAGGCTGCTCGGAAAATTTATCCGC
GAGTGCCAAGGGCCAATAAAGTCTCCAGATGATGTGATTATCGCAACTAAGTTTGCTGCGTATCCTTGGCGACTAACGTCAGGCCAGTTTGTCAACGCCT
GCAAGTCATCATTAGAAAGGTTACAGATCGATCGGCTCGGAATAGGGCAGCTGCATTGGTCTACTGCTAACTATGCACCTCTGCAGGAGCGCGCTCTCTG
GGACGGTCTAGTTGAAATGTATGACAAGGGTCTTGTCCGAGCCGTGGGTGTGAGCAATTATGGGCCGAAGCAGCTTGTGAAGATCCACAGCTACCTAGCA
TCCAGAGGTGTCCCCCTGAGCTCAGCTCAGGTGCAGTTCTCGCTGCTGAGCATGGGCGATGAGCAGATGGAGCTGAAAACCGTGTGCGATTCCCTGGGTG
TTCAGCTAATCGCTTATAGCCCTCTTGGGTTGGGCATGCTCACCGGGAAATATGACGCCTCTAACCTTCCAAATGGGCCAAGATCTGTGTTGTTCCGGCA
GATTCTTCCTGGGCTGGAATCCCTGCTGTCTTGCTTGAAGAGTATTGCCGACCGAAAGGGCAAAACCATGTCCCAGGTGGCTATAAACTGGTGCGTTTGC
AAAGGCGCAATTCCGATTCCCGGCGTGAAGACAGTGAGGCACGTGGAGGACAACTTGGGCGCGCTCGGCTGGAGGCTGAGCCCTGATGAGATCTCAGAGC
TGGAAGCCGCGGCGATGGAGTGCCCCAAGAAGATGGTTCAGAACATATTTCAGACCGCATGAGCAAACTGGAAACTGCAGTAACGCCAATATTAAACACG
ACAGCAACCTGCAGAAAAGAGACATGTTGCTTCCTCTTCTCTGCCTAGTTCAGAGTTCAGTTCAGAACTTAAGAGTTCAGAGACATGCCATTG
page-top