Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6499  (registered. 2012)
Contig Information
Length 1022 bp
Clones alternative view 15 Clones [Download: TSV  ,  FASTA ]
Wh_V4816 Shoot grown under cold condition for 16days 7
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VHS Shoot with heat shock treatment 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|31753114|gb|AAH53854.1|| Unknown (protein for IMAGE:5194336) [Homo sapiens]
Score 522
Evalue 3.00E-146
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6499
GTTCATCGTTCTCATTTCTCATGGAGCAACACACAGGCTACATCCAGGACATGAAGCAAGCGGGCAGATCAGACCATTTCCCCCCAGAGATCATTGTAAT
TTACACCATGATGTCACAATTTGAACCACGCATTGTGTGTGCAGTTCACTGCAGTTGCCTTGATGGCTACAACTCGCAGGTAGCGAGCGCCGACGCCTCA
CTTGCCGGGAACAAAGTTTGTGGCAAACGCCCATGCGTTGTTGTTGACAGGGTCAGAGAGGTGGTCGGCGAGGTTCTCGAGTGGGCCCTTGCCGGTGACG
ATGGCCTGCACGAAGAAGCCAAACATAGAGAACATGGCAAGGCGTCCGTTCTTGACTTCCTTCACCTTGAGCTCCGCGAATGCCTCTGGATCGTCAGCCA
GGCCTAGTGGGTCAAAGCTGCCGCCAGGGTAGAGTGGGTCGACTATCTCACCAAGTGGGCCGCCGGCAACGCGGTACCCTTCAACGGCACCCATGAGCAC
GACTTGGCATGCCCAGATAGCAAGGATGCTCTGTGCATGCACGAGGCTGGGGTTGCCGAGGTAGTCAAGGCCACCCTCGCTGAAGATCTGGGAACCGGCC
TTGAACCATACGGCCTCACCGAACTTGACGCCGTTGCGTGCAAGAAGCTCGGGGAAGACGCATCCGAGCGCACCAAGCATGGCCCACCGGCAGTGGATCA
CCTCGAGCTCCCGGTTCTTGGCAAAGGTCTCAGGATCGGCCGATAGCCCGGCGGTGTCCCACCCATAGTCGCCGGGGAACTCGCCAGTCAAGTAGCTCGG
GGGCTCTCCAGAAAGCGGGCCGAGGTAGAGCACACGGTCAGCACCGTACCACGGGCTGCCTGATGAAACTGGCTTGGCCTTTGCAGCGGTCTTGCGCATA
GTGACACGGGCCTCACCAAAGAGAGCTGATGAAGCCACGTTCTTCACTGACTCGCCGGCTAAGGCCGAGGAGAGGGACATGGTGGTAGTCGCCATTGCGC
TGCTAAGGCGGGAGGTGTATTG
page-top